Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PRDM14 cdna clone

PRDM14 cDNA Clone

Gene Names
PRDM14; PFM11
Synonyms
PRDM14; PRDM14 cDNA Clone; PRDM14 cdna clone
Ordering
For Research Use Only!
Sequence
atggctctaccccggccaagtgaggccgtgcctcaggacaaggtgtgctacccgccggagagcagcccgcagaacctggccgcgtactacacgcctttcccgtcctatggacactacagaaacagcctggccaccgtggaggaagacttccaacctttccggcagctggaggccgcagcgtctgctgcccccgccatgccccccttccccttccggatggcgcctcccttgctgagcccgggtctgggcctacagagggagcctctctacgatctgccctggtacagcaagctgccaccgtggtacccaattccccacgtccccagggaagtgccgcccttcctgagcagcagccacgagtacgcgggtgccagcagtgaagatctgggccaccaaatcattggtggcgacaacgagagtggcccgtgttgtggacctgacactttaattccaccgccccctgcggatgcttctctgttacctgaggggctgaggacctcccagttattaccttgctcacccagcaagcagtcagaggatggtcccaaaccctccaaccaagaagggaagtcccctgctcggttccagttcacggaggaggacctgcacttcgttctgtacggggtcactcccagcctggagcacccagccagcctgcaccatgcgatttcaggcctcctggtccccccagacagctctggatctgattctcttcctcaaactctggatgaagactcccttcaacttccagaaggtctatgcctcatgcagacggtgtttggtgaagtcccacattttggtgtgttctgcagtagttttatcgccaaaggagtcaggtttgggccctttcaaggtaaagtggtcaatgccagtgaagtgaagacctacggagacaattctgtgatgtgggagatctttgaagatggtcatttgagccactttatagatggaaaaggaggtacggggaactggatgtcctatgtcaactgtgcccgcttccccaaggagcagaacctagttgctgtgcagtgtcaagggcatatattttatgagagctgcaaagagattcatcagaaccaagagctccttgtgtggtatggagactgctatgagaaatttctggatattcctgtgagccttcaggtcacagagccggggaagcagccatctgggccctctgaagagtctgcagaaggctacagatgtgaaagatgtgggaaggtatttacctacaaatattacagagataagcacctcaagtacaccccctgtgtggacaagggcgataggaaatttccctgttctctctgcaaacgatcctttgagaagcgggaccggcttcggatccacattcttcatgttcatgagaagcaccggcctcacaagtgttctacatgtgggaaatgtttctctcagtcttccagcctaaacaaacacatgcgagtccactctggagacagaccataccagtgtgtgtattgtactaagaggttcacagcctccagcatactccgcacacacatcaggcagcactccggggagaagcccttcaaatgcaagtactgtggtaaatcttttgcatcccatgctgcccatgacagccatgtccggcgttcacacaaggaggacgatggctgctcatgcagcatctgtgggaaaatcttctcagatcaagaaacattctactcccacatgaagtttcatgaagactactag
Sequence Length
1716
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
64,062 Da
NCBI Official Full Name
Homo sapiens PR domain containing 14, mRNA
NCBI Official Synonym Full Names
PR/SET domain 14
NCBI Official Symbol
PRDM14
NCBI Official Synonym Symbols
PFM11
NCBI Protein Information
PR domain zinc finger protein 14
UniProt Protein Name
PR domain zinc finger protein 14
UniProt Gene Name
PRDM14
UniProt Entry Name
PRD14_HUMAN

NCBI Description

This gene encodes a member of the PRDI-BF1 and RIZ homology domain containing (PRDM) family of transcriptional regulators. The encoded protein may possess histone methyltransferase activity and plays a critical role in cell pluripotency by suppressing the expression of differentiation marker genes. Expression of this gene may play a role in breast cancer. [provided by RefSeq, Dec 2011]

Uniprot Description

PRDM14: a probable protein lysine methyltransferase that works in concert with the core human embryonic stem cell (ESC) regulators to control pluripotency associated genes. Binds to silenced genes in human ESCs. Its binding profile is enriched for the repressive tri-methylation of histone H3 lysine 27 (H3K27me3) modification. Interacts directly with the polycomb repressive complex 2 (PRC2). PRC2 is detected at PRDM14-bound loci in human ESCs. A probable transcriptional regulator of the krueppel C2H2-type zinc-finger protein family. Has both positive and negative roles on transcription. Required for the maintenance of emryonic stem cell identity and the reacquisition of pluripotency in somatic cells. May play an essential role in germ cell development at 2 levels: the reacquisition of potential pluripotency, including SOX2 up-regulation, and successful epigenetic reprogramming. Directly up-regulates the expression of pluripotency gene POU5F1 through its proximal enhancer. Binds to the DNA consensus sequence 5'-GGTC[TC]CTAA-3'.

Protein type: Methyltransferase, protein arginine, predicted; C2H2-type zinc finger protein

Chromosomal Location of Human Ortholog: 8q13.3

Cellular Component: nucleoplasm

Molecular Function: protein binding

Biological Process: somatic stem cell maintenance

Research Articles on PRDM14

Similar Products

Product Notes

The PRDM14 prdm14 (Catalog #AAA1276105) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggctctac cccggccaag tgaggccgtg cctcaggaca aggtgtgcta cccgccggag agcagcccgc agaacctggc cgcgtactac acgcctttcc cgtcctatgg acactacaga aacagcctgg ccaccgtgga ggaagacttc caacctttcc ggcagctgga ggccgcagcg tctgctgccc ccgccatgcc ccccttcccc ttccggatgg cgcctccctt gctgagcccg ggtctgggcc tacagaggga gcctctctac gatctgccct ggtacagcaa gctgccaccg tggtacccaa ttccccacgt ccccagggaa gtgccgccct tcctgagcag cagccacgag tacgcgggtg ccagcagtga agatctgggc caccaaatca ttggtggcga caacgagagt ggcccgtgtt gtggacctga cactttaatt ccaccgcccc ctgcggatgc ttctctgtta cctgaggggc tgaggacctc ccagttatta ccttgctcac ccagcaagca gtcagaggat ggtcccaaac cctccaacca agaagggaag tcccctgctc ggttccagtt cacggaggag gacctgcact tcgttctgta cggggtcact cccagcctgg agcacccagc cagcctgcac catgcgattt caggcctcct ggtcccccca gacagctctg gatctgattc tcttcctcaa actctggatg aagactccct tcaacttcca gaaggtctat gcctcatgca gacggtgttt ggtgaagtcc cacattttgg tgtgttctgc agtagtttta tcgccaaagg agtcaggttt gggccctttc aaggtaaagt ggtcaatgcc agtgaagtga agacctacgg agacaattct gtgatgtggg agatctttga agatggtcat ttgagccact ttatagatgg aaaaggaggt acggggaact ggatgtccta tgtcaactgt gcccgcttcc ccaaggagca gaacctagtt gctgtgcagt gtcaagggca tatattttat gagagctgca aagagattca tcagaaccaa gagctccttg tgtggtatgg agactgctat gagaaatttc tggatattcc tgtgagcctt caggtcacag agccggggaa gcagccatct gggccctctg aagagtctgc agaaggctac agatgtgaaa gatgtgggaa ggtatttacc tacaaatatt acagagataa gcacctcaag tacaccccct gtgtggacaa gggcgatagg aaatttccct gttctctctg caaacgatcc tttgagaagc gggaccggct tcggatccac attcttcatg ttcatgagaa gcaccggcct cacaagtgtt ctacatgtgg gaaatgtttc tctcagtctt ccagcctaaa caaacacatg cgagtccact ctggagacag accataccag tgtgtgtatt gtactaagag gttcacagcc tccagcatac tccgcacaca catcaggcag cactccgggg agaagccctt caaatgcaag tactgtggta aatcttttgc atcccatgct gcccatgaca gccatgtccg gcgttcacac aaggaggacg atggctgctc atgcagcatc tgtgggaaaa tcttctcaga tcaagaaaca ttctactccc acatgaagtt tcatgaagac tactag. It is sometimes possible for the material contained within the vial of "PRDM14, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.