Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

TSTA3 cdna clone

TSTA3 cDNA Clone

Gene Names
TSTA3; FX; P35B; SDR4E1
Synonyms
TSTA3; TSTA3 cDNA Clone; TSTA3 cdna clone
Ordering
For Research Use Only!
Sequence
atgggtgaaccccagggatccatgcggattctagtgacagggggctctgggctggtaggcaaagccatccagaaggtggtagcagatggagctggacttcctggagaggactgggtgtttgtctcctctaaagacgccgatctcacggatacagcacagacccgcgccctgtttgagaaggtccaacccacacacgtcatccatcttgctgcaatggtggggggcctgttccggaatatcaaatacaatttggacttctggaggaaaaacgtgcacatgaacgacaacgtcctgcactcggcctttgaggtgggcgcccgcaaggtggtgtcctgcctgtccacctgtatcttccctgacaagacgacctacccgatagatgagaccatgatccacaatgggcctccccacaacagcaattttgggtactcgtatgccaagaggatgatcgacgtgcagaacagggcctacttccagcagtacggctgcaccttcaccgctgtcatccccaccaacgtcttcgggccccacgacaacttcaacatcgaggatggccacgtgctgcctggcctcatccacaaggtgcacctggccaagagcagcggctcggccctgacggtgtggggtacagggaatccgcggaggcagttcatatactcgctggacctggcccagctctttatctgggtcctgcgggagtacaatgaagtggagcccatcatcctctccgtgggcgaggaagatgaggtctccatcaaggaggcagccgaggcggtggtggaggccatggacttccatggggaagtcacctttgatacaaccaagtcggatgggcagtttaagaagacagccagtaacagcaagctgaggacctacctgcccgacttccggttcacacccttcaagcaggcggtgaaggagacctgtgcttggttcactgacaactacgagcaggcccggaagtga
Sequence Length
966
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
35,893 Da
NCBI Official Full Name
Homo sapiens tissue specific transplantation antigen P35B, mRNA
NCBI Official Synonym Full Names
tissue specific transplantation antigen P35B
NCBI Official Symbol
TSTA3
NCBI Official Synonym Symbols
FX; P35B; SDR4E1
NCBI Protein Information
GDP-L-fucose synthase
UniProt Protein Name
GDP-L-fucose synthase
UniProt Gene Name
TSTA3
UniProt Synonym Gene Names
SDR4E1
UniProt Entry Name
FCL_HUMAN

NCBI Description

Tissue specific transplantation antigen P35B is a NADP(H)-binding protein. It catalyze the two-step epimerase and the reductase reactions in GDP-D-mannose metabolism, converting GDP-4-keto-6-D-deoxymannose to GDP-L-fucose. GDP-L-fucose is the substrate of several fucosyltransferases involved in the expression of many glycoconjugates, including blood group ABH antigens and developmental adhesion antigens. Mutations in this gene may cause leukocyte adhesion deficiency, type II. [provided by RefSeq, Jul 2008]

Uniprot Description

TSTA3: Two step NADP-dependent conversion of GDP-4-dehydro-6- deoxy-D-mannose to GDP-fucose, involving an epimerase and a reductase reaction. Belongs to the fucose synthase family.

Protein type: Carbohydrate Metabolism - fructose and mannose; Carbohydrate Metabolism - amino sugar and nucleotide sugar; EC 1.1.1.271; Oxidoreductase

Chromosomal Location of Human Ortholog: 8q24.3

Cellular Component: cytoplasm; cytosol

Molecular Function: electron carrier activity; GDP-4-dehydro-D-rhamnose reductase activity; GDP-L-fucose synthase activity; isomerase activity

Biological Process: 'de novo' GDP-L-fucose biosynthetic process; GDP-mannose metabolic process

Research Articles on TSTA3

Similar Products

Product Notes

The TSTA3 tsta3 (Catalog #AAA1276015) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgggtgaac cccagggatc catgcggatt ctagtgacag ggggctctgg gctggtaggc aaagccatcc agaaggtggt agcagatgga gctggacttc ctggagagga ctgggtgttt gtctcctcta aagacgccga tctcacggat acagcacaga cccgcgccct gtttgagaag gtccaaccca cacacgtcat ccatcttgct gcaatggtgg ggggcctgtt ccggaatatc aaatacaatt tggacttctg gaggaaaaac gtgcacatga acgacaacgt cctgcactcg gcctttgagg tgggcgcccg caaggtggtg tcctgcctgt ccacctgtat cttccctgac aagacgacct acccgataga tgagaccatg atccacaatg ggcctcccca caacagcaat tttgggtact cgtatgccaa gaggatgatc gacgtgcaga acagggccta cttccagcag tacggctgca ccttcaccgc tgtcatcccc accaacgtct tcgggcccca cgacaacttc aacatcgagg atggccacgt gctgcctggc ctcatccaca aggtgcacct ggccaagagc agcggctcgg ccctgacggt gtggggtaca gggaatccgc ggaggcagtt catatactcg ctggacctgg cccagctctt tatctgggtc ctgcgggagt acaatgaagt ggagcccatc atcctctccg tgggcgagga agatgaggtc tccatcaagg aggcagccga ggcggtggtg gaggccatgg acttccatgg ggaagtcacc tttgatacaa ccaagtcgga tgggcagttt aagaagacag ccagtaacag caagctgagg acctacctgc ccgacttccg gttcacaccc ttcaagcagg cggtgaagga gacctgtgct tggttcactg acaactacga gcaggcccgg aagtga. It is sometimes possible for the material contained within the vial of "TSTA3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.