Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

LIMS1 cdna clone

LIMS1 cDNA Clone

Gene Names
LIMS1; PINCH; PINCH1; PINCH-1
Synonyms
LIMS1; LIMS1 cDNA Clone; LIMS1 cdna clone
Ordering
For Research Use Only!
Sequence
atggccaacgccctggccagcgccacttgcgagcgctgcaagggcggctttgcgcccgctgagaagatcgtgaacagtaatggggagctgtaccatgagcagtgtttcgtgtgcgctcagtgcttccagcagttcccagaaggactcttctatgagtttgaaggaagaaagtactgtgaacatgactttcagatgctctttgccccttgctgtcatcagtgtggtgaattcaccattggccgagttatcaaagccatgaataacagctggcatccggagtgcttccgctgtgacctctgccaggaagttctggcagatatcgggtttgtcaagaatgctgggagacacctgtgtcgcccctgtcataatcgtgagaaagccagaggccttgggaaatacatctgccagaaatgccatgctatcatcgatgagcagcctctgatattcaagaacgacccctaccatccagaccatttcaactgcgccaactgcgggaaggagctgactgccgatgcacgggagctgaaaggggagctatactgcctcccatgccatgataaaatgggggtccccatctgtggtgcttgccgacggcccatcgaagggcgcgtggtgaacgctatgggcaagcagtggcatgtggagcattttgtttgtgccaagtgtgagaaaccctttcttggacatcgccattatgagaggaaaggcctggcatattgtgaaactcactataaccagctatttggtgatgtttgcttccactgcaatcgtgttatagaaggtggtgtggtctctgctcttaataaggcctggtgcgtgaactgctttgcctgttctacctgcaacactaaattaacactcaagaataagtttgtggagtttgacatgaagccagtctgtaagaagtgctatgagaaatttccattggagctgaagaaaagacttaagaaactagctgagaccttaggaaggaaataa
Sequence Length
978
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
41,571 Da
NCBI Official Full Name
Homo sapiens LIM and senescent cell antigen-like domains 1, mRNA
NCBI Official Synonym Full Names
LIM zinc finger domain containing 1
NCBI Official Symbol
LIMS1
NCBI Official Synonym Symbols
PINCH; PINCH1; PINCH-1
NCBI Protein Information
LIM and senescent cell antigen-like-containing domain protein 1
UniProt Protein Name
LIM and senescent cell antigen-like-containing domain protein 1
UniProt Gene Name
LIMS1
UniProt Synonym Gene Names
PINCH; PINCH1; PINCH-1
UniProt Entry Name
LIMS1_HUMAN

NCBI Description

The protein encoded by this gene is an adaptor protein which contains five LIM domains, or double zinc fingers. The protein is likely involved in integrin signaling through its LIM domain-mediated interaction with integrin-linked kinase, found in focal adhesion plaques. It is also thought to act as a bridge linking integrin-linked kinase to NCK adaptor protein 2, which is involved in growth factor receptor kinase signaling pathways. Its localization to the periphery of spreading cells also suggests that this protein may play a role in integrin-mediated cell adhesion or spreading. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2010]

Uniprot Description

LIMS1: Effector of integrin and growth factor signaling, coupling surface receptors to downstream signaling molecules involved in the regulation of cell survival, cell proliferation and cell differentiation. Focal adhesion protein part of the complex ILK-PINCH. This complex is considered to be one of the convergence points of integrin- and growth factor-signaling pathway. 5 isoforms of the human protein are produced by alternative splicing.

Protein type: Adaptor/scaffold; Motility/polarity/chemotaxis

Chromosomal Location of Human Ortholog: 2q12.3

Cellular Component: cytosol; focal adhesion; intercellular junction; perinuclear region of cytoplasm

Molecular Function: protein binding; protein kinase binding; zinc ion binding

Biological Process: cell aging; epithelial to mesenchymal transition; establishment of protein localization; negative regulation of transcription, DNA-dependent; positive regulation of focal adhesion formation; positive regulation of GTPase activity; regulation of epithelial cell proliferation

Research Articles on LIMS1

Similar Products

Product Notes

The LIMS1 lims1 (Catalog #AAA1275997) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggccaacg ccctggccag cgccacttgc gagcgctgca agggcggctt tgcgcccgct gagaagatcg tgaacagtaa tggggagctg taccatgagc agtgtttcgt gtgcgctcag tgcttccagc agttcccaga aggactcttc tatgagtttg aaggaagaaa gtactgtgaa catgactttc agatgctctt tgccccttgc tgtcatcagt gtggtgaatt caccattggc cgagttatca aagccatgaa taacagctgg catccggagt gcttccgctg tgacctctgc caggaagttc tggcagatat cgggtttgtc aagaatgctg ggagacacct gtgtcgcccc tgtcataatc gtgagaaagc cagaggcctt gggaaataca tctgccagaa atgccatgct atcatcgatg agcagcctct gatattcaag aacgacccct accatccaga ccatttcaac tgcgccaact gcgggaagga gctgactgcc gatgcacggg agctgaaagg ggagctatac tgcctcccat gccatgataa aatgggggtc cccatctgtg gtgcttgccg acggcccatc gaagggcgcg tggtgaacgc tatgggcaag cagtggcatg tggagcattt tgtttgtgcc aagtgtgaga aaccctttct tggacatcgc cattatgaga ggaaaggcct ggcatattgt gaaactcact ataaccagct atttggtgat gtttgcttcc actgcaatcg tgttatagaa ggtggtgtgg tctctgctct taataaggcc tggtgcgtga actgctttgc ctgttctacc tgcaacacta aattaacact caagaataag tttgtggagt ttgacatgaa gccagtctgt aagaagtgct atgagaaatt tccattggag ctgaagaaaa gacttaagaa actagctgag accttaggaa ggaaataa. It is sometimes possible for the material contained within the vial of "LIMS1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.