Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

TSHB cdna clone

TSHB cDNA Clone

Gene Names
TSHB; TSH-B; TSH-BETA
Synonyms
TSHB; TSHB cDNA Clone; TSHB cdna clone
Ordering
For Research Use Only!
Sequence
atgactgctctctttctgatgtccatgctttttggccttgcatgtgggcaagcgatgtctttttgtattccaactgagtatacaatgcacatcgaaaggagagagtgtgcttattgcctaaccatcaacaccaccatctgtgctggatattgtatgacacgggatatcaatggcaaactgtttcttcccaaatatgctctgtcccaggatgtttgcacatatagagacttcatctacaggactgtagaaataccaggatgcccactccatgttgctccctatttttcctatcctgttgctttaagctgtaagtgtggcaagtgcaatactgactatagtgactgcatacatgaagccatcaagacaaactactgtaccaaacctcagaagtcttatctggtaggattttctgtctaa
Sequence Length
417
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
10,624 Da
NCBI Official Full Name
Homo sapiens thyroid stimulating hormone, beta, mRNA
NCBI Official Synonym Full Names
thyroid stimulating hormone beta
NCBI Official Symbol
TSHB
NCBI Official Synonym Symbols
TSH-B; TSH-BETA
NCBI Protein Information
thyrotropin subunit beta
UniProt Protein Name
Thyrotropin subunit beta
Protein Family
UniProt Gene Name
TSHB
UniProt Synonym Gene Names
TSH-B; TSH-beta
UniProt Entry Name
TSHB_HUMAN

NCBI Description

The four human glycoprotein hormones chorionic gonadotropin (CG), luteinizing hormone (LH), follicle stimulating hormone (FSH), and thyroid stimulating hormone (TSH) are dimers consisting of alpha and beta subunits that are associated noncovalently. The alpha subunits of these hormones are identical, however, their beta chains are unique and confer biological specificity. Thyroid stimulating hormone functions in the control of thyroid structure and metabolism. The protein encoded by this gene is the beta subunit of thyroid stimulating hormone. Mutations in this gene are associated with congenital central and secondary hypothyroidism and Hashimoto's thyroiditis. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, May 2013]

Uniprot Description

TSHB: Indispensable for the control of thyroid structure and metabolism. Belongs to the glycoprotein hormones subunit beta family.

Protein type: Secreted, signal peptide; Secreted

Chromosomal Location of Human Ortholog: 1p13

Cellular Component: extracellular region

Biological Process: anatomical structure morphogenesis; cell-cell signaling; G-protein coupled receptor protein signaling pathway; peptide hormone processing

Disease: Hypothyroidism, Congenital, Nongoitrous, 4

Research Articles on TSHB

Similar Products

Product Notes

The TSHB tshb (Catalog #AAA1275988) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgactgctc tctttctgat gtccatgctt tttggccttg catgtgggca agcgatgtct ttttgtattc caactgagta tacaatgcac atcgaaagga gagagtgtgc ttattgccta accatcaaca ccaccatctg tgctggatat tgtatgacac gggatatcaa tggcaaactg tttcttccca aatatgctct gtcccaggat gtttgcacat atagagactt catctacagg actgtagaaa taccaggatg cccactccat gttgctccct atttttccta tcctgttgct ttaagctgta agtgtggcaa gtgcaatact gactatagtg actgcataca tgaagccatc aagacaaact actgtaccaa acctcagaag tcttatctgg taggattttc tgtctaa. It is sometimes possible for the material contained within the vial of "TSHB, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.