Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PVRL4 cdna clone

PVRL4 cDNA Clone

Gene Names
NECTIN4; LNIR; PRR4; EDSS1; PVRL4; nectin-4
Synonyms
PVRL4; PVRL4 cDNA Clone; PVRL4 cdna clone
Ordering
For Research Use Only!
Sequence
atgcccctgtccctgggagccgagatgtgggggcctgaggcctggctgctgctgctgctactgctggcatcatttacaggccggtgccccgcgggtgagctggagacctcagacgtggtaactgtggtgctgggccaggacgcaaaactgccctgcttctaccgaggggactccggcgagcaagtggggcaagtggcatgggctcgggtggacgcgggcgaaggcgcccaggaactagcgctactgcactccaaatacgggcttcatgtgagcccggcttacgagggccgcgtggagcagccgccgcccccacgcaaccccctggacggctcagtgctcctgcgcaacgcagtgcaggcggatgagggcgagtacgagtgccgggtcagcaccttccccgccggcagcttccaggcgcggctgcggctccgagtgctggtgcctcccctgccctcactgaatcctggtccagcactagaagagggccagggcctgaccctggcagcctcctgcacagctgagggcagcccagcccccagcgtgacctgggacacggaggtcaaaggcacaacgtccagccgttccttcaagcactcccgctctgctgccgtcacctcagagttccacttggtgcctagccgcagcatgaatgggcagccactgacttgtgtggtgtcccatcctggcctgctccaggaccaaaggatcacccacatcctccacgtgtccttccttgctgaggcctctgtgaggggccttgaagaccaaaatctgtggcacattggcagagaaggagctatgctcaagtgcctgagtgaagggcagccccctccctcatacaactggacacggctggatgggcctctgcccagtggggtacgagtggatggggacactttgggctttcccccactgaccactgagcacagcggcatctacgtctgccatgtcagcaatgagttctcctcaagggattctcaggtcactgtggatgttcttgacccccaggaagactctgggaagcaggtggacctagtgtcagcctcggtggtggtggtgggtgtgatcgccgcactcttgttctgccttctggtggtggtggtggtgctcatgtcccgataccatcggcgcaaggcccagcagatgacccagaaatatgaggaggagctgaccctgaccagggagaactccatccggaggctgcattcccatcacacggaccccaggagccagccggaggagagtgtagggctgagagccgagggccaccctgatagtctcaaggacaacagtagctgctctgtgatgagtgaagagcccgagggccgcagttactccacgctgaccacggtgagggagatagaaacacagactgaactgctgtctccaggctctgggcgggccgaggaggaggaagatcaggatgaaggcatcaaacaggccatgaaccattttgttcaggagaatgggaccctacgggccaagcccacgggcaatggcatctacatcaatgggcggggacacctggtctga
Sequence Length
1533
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
24,341 Da
NCBI Official Full Name
Homo sapiens poliovirus receptor-related 4, mRNA
NCBI Official Synonym Full Names
nectin cell adhesion molecule 4
NCBI Official Symbol
NECTIN4
NCBI Official Synonym Symbols
LNIR; PRR4; EDSS1; PVRL4; nectin-4
NCBI Protein Information
nectin-4
UniProt Protein Name
Nectin-4
UniProt Gene Name
NECTIN4
UniProt Entry Name
NECT4_HUMAN

NCBI Description

This gene encodes a member of the nectin family. The encoded protein contains two immunoglobulin-like (Ig-like) C2-type domains and one Ig-like V-type domain. It is involved in cell adhesion through trans-homophilic and -heterophilic interactions. It is a single-pass type I membrane protein. The soluble form is produced by proteolytic cleavage at the cell surface by the metalloproteinase ADAM17/TACE. The secreted form is found in both breast tumor cell lines and breast tumor patients. Mutations in this gene are the cause of ectodermal dysplasia-syndactyly syndrome type 1, an autosomal recessive disorder. Alternatively spliced transcript variants have been found but the full-length nature of the variant has not been determined.[provided by RefSeq, Jan 2011]

Uniprot Description

nectin 4: Seems to be involved in cell adhesion through trans- homophilic and -heterophilic interactions, the latter including specifically interactions with PVRL2/nectin-1. Does not act as receptor for alpha-herpesvirus entry into cells. Defects in PVRL4 are the cause of ectodermal dysplasia- syndactyly syndrome type 1 (EDSS1). EDSS1 is a form of ectodermal dysplasia, a heterogeneous group of disorders due to abnormal development of two or more ectodermal structures. EDSS1 is characterized by the association of hair and teeth abnormalities with cutaneous syndactyly of the hands and/or feet. Hair morphologic abnormalities include twists at irregular intervals (pilli torti) and swelling along the shafts, particularly associated with areas of breakage. Dental findings consist of abnormally widely spaced teeth, with peg-shaped and conical crowns. Patients have normal sweating. Belongs to the nectin family.

Protein type: Cell adhesion; Membrane protein, integral

Chromosomal Location of Human Ortholog: 1q23.3

Cellular Component: cell-cell adherens junction; integral to plasma membrane; intercellular junction; plasma membrane

Molecular Function: cell adhesion molecule binding; protein binding; protein homodimerization activity; receptor activity; receptor binding

Biological Process: cell recognition; heterophilic cell adhesion; homophilic cell adhesion

Disease: Ectodermal Dysplasia-syndactyly Syndrome 1

Research Articles on PVRL4

Similar Products

Product Notes

The PVRL4 nectin4 (Catalog #AAA1275974) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcccctgt ccctgggagc cgagatgtgg gggcctgagg cctggctgct gctgctgcta ctgctggcat catttacagg ccggtgcccc gcgggtgagc tggagacctc agacgtggta actgtggtgc tgggccagga cgcaaaactg ccctgcttct accgagggga ctccggcgag caagtggggc aagtggcatg ggctcgggtg gacgcgggcg aaggcgccca ggaactagcg ctactgcact ccaaatacgg gcttcatgtg agcccggctt acgagggccg cgtggagcag ccgccgcccc cacgcaaccc cctggacggc tcagtgctcc tgcgcaacgc agtgcaggcg gatgagggcg agtacgagtg ccgggtcagc accttccccg ccggcagctt ccaggcgcgg ctgcggctcc gagtgctggt gcctcccctg ccctcactga atcctggtcc agcactagaa gagggccagg gcctgaccct ggcagcctcc tgcacagctg agggcagccc agcccccagc gtgacctggg acacggaggt caaaggcaca acgtccagcc gttccttcaa gcactcccgc tctgctgccg tcacctcaga gttccacttg gtgcctagcc gcagcatgaa tgggcagcca ctgacttgtg tggtgtccca tcctggcctg ctccaggacc aaaggatcac ccacatcctc cacgtgtcct tccttgctga ggcctctgtg aggggccttg aagaccaaaa tctgtggcac attggcagag aaggagctat gctcaagtgc ctgagtgaag ggcagccccc tccctcatac aactggacac ggctggatgg gcctctgccc agtggggtac gagtggatgg ggacactttg ggctttcccc cactgaccac tgagcacagc ggcatctacg tctgccatgt cagcaatgag ttctcctcaa gggattctca ggtcactgtg gatgttcttg acccccagga agactctggg aagcaggtgg acctagtgtc agcctcggtg gtggtggtgg gtgtgatcgc cgcactcttg ttctgccttc tggtggtggt ggtggtgctc atgtcccgat accatcggcg caaggcccag cagatgaccc agaaatatga ggaggagctg accctgacca gggagaactc catccggagg ctgcattccc atcacacgga ccccaggagc cagccggagg agagtgtagg gctgagagcc gagggccacc ctgatagtct caaggacaac agtagctgct ctgtgatgag tgaagagccc gagggccgca gttactccac gctgaccacg gtgagggaga tagaaacaca gactgaactg ctgtctccag gctctgggcg ggccgaggag gaggaagatc aggatgaagg catcaaacag gccatgaacc attttgttca ggagaatggg accctacggg ccaagcccac gggcaatggc atctacatca atgggcgggg acacctggtc tga. It is sometimes possible for the material contained within the vial of "PVRL4, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.