Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

TRIM39 cdna clone

TRIM39 cDNA Clone

Gene Names
TRIM39; TFP; RNF23; TRIM39B
Synonyms
TRIM39; TRIM39 cDNA Clone; TRIM39 cdna clone
Ordering
For Research Use Only!
Sequence
atggcagagacaagtctgttagaggctggggcctctgcagcctctacagctgcggctttggagaacttacaggtggaggcgagctgctctgtgtgcctggagtatctgaaggaacctgtcatcattgagtgtgggcacaacttctgcaaagcttgcatcacccgctggtgggaggacctagagagggacttcccttgtcctgtctgtcgaaagacatcccgctaccgcagtctccgacctaatcggcaactaggcagtatggtggaaattgccaagcagctccaggccgtcaagcggaagatccgggatgagagcctctgcccccaacaccatgaggccctcagccttttctgttatgaggaccaggaggctgtatgcttgatatgtgcaatttcccacacccaccgggcccacaccgttgtgccactggacgatgctacacaggagtacaaggaaaaactgcagaagtgtctggagcccctggaacagaagctgcaggagatcactcgctgcaagtcctctgaggagaagaagcctggtgagctcaagagactagtggaaagtcgccgacagcagatcttgagggagtttgaagagcttcataggcggctggatgaagagcagcaggtgttgctttcacgactggaagaagaggaacaggacattctgcagcgactccgagaaaatgctgctcaccttggggacaagcgccgggacctggcccacttggctgccgaggtggagggcaagtgcttacagtcaggcttcgagatgcttaaggatgtcaaaagtaccctggaaaaatgtgaaaaggtgaagaccatggaggtgacttcagtatccatagagctggaaaagaacttcagcaattttccccgacagtactttgccctaaggaaaatccttaaacagctaattgcggatgtgaccctggaccctgagacagctcatcctaacctagtcctgtcagaggatcgtaagagcgtcaagttcgtggagacaagactccgggatctccctgacacaccaaggcgtttcaccttctacccttgcgtcctggctactgagggtttcacctcaggtcgacactactgggaggtggaggtgggcgacaagacccactgggcagtgggtgtatgccgggactccgtgagccgaaagggcgagttgactccactccctgagactggctactggcgggtgcggctatggaatggggacaaatatgcagccaccaccacaccttttacccctttgcacatcaaggtgaaacccaagcgggtaggcatattcctagactatgaggccggcacactgtctttctacaatgtcacagaccgctctcatatctacaccttcactgatacttttactgagaaactttggcccctcttctacccaggcatccgggctggacggaagaatgctgcaccacttaccatcaggcccccaacagattgggagtga
Sequence Length
1467
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
56,374 Da
NCBI Official Full Name
Homo sapiens tripartite motif-containing 39, mRNA
NCBI Official Synonym Full Names
tripartite motif containing 39
NCBI Official Symbol
TRIM39
NCBI Official Synonym Symbols
TFP; RNF23; TRIM39B
NCBI Protein Information
E3 ubiquitin-protein ligase TRIM39
UniProt Protein Name
E3 ubiquitin-protein ligase TRIM39
UniProt Gene Name
TRIM39
UniProt Synonym Gene Names
RNF23; TFP
UniProt Entry Name
TRI39_HUMAN

NCBI Description

The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. The function of this protein has not been identified. This gene lies within the major histocompatibility complex class I region on chromosome 6. Alternate splicing results in two transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]

Uniprot Description

TRIM39: E3 ubiquitin-protein ligase. May facilitate apoptosis by inhibiting APC/C-Cdh1-mediated poly-ubiquitination and subsequent proteasome-mediated degradation of the pro-apoptotic protein MOAP1. Belongs to the TRIM/RBCC family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Ubiquitin conjugating system

Chromosomal Location of Human Ortholog: 6p21.3

Cellular Component: cytosol; mitochondrion

Molecular Function: identical protein binding; protein binding

Research Articles on TRIM39

Similar Products

Product Notes

The TRIM39 trim39 (Catalog #AAA1275941) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcagaga caagtctgtt agaggctggg gcctctgcag cctctacagc tgcggctttg gagaacttac aggtggaggc gagctgctct gtgtgcctgg agtatctgaa ggaacctgtc atcattgagt gtgggcacaa cttctgcaaa gcttgcatca cccgctggtg ggaggaccta gagagggact tcccttgtcc tgtctgtcga aagacatccc gctaccgcag tctccgacct aatcggcaac taggcagtat ggtggaaatt gccaagcagc tccaggccgt caagcggaag atccgggatg agagcctctg cccccaacac catgaggccc tcagcctttt ctgttatgag gaccaggagg ctgtatgctt gatatgtgca atttcccaca cccaccgggc ccacaccgtt gtgccactgg acgatgctac acaggagtac aaggaaaaac tgcagaagtg tctggagccc ctggaacaga agctgcagga gatcactcgc tgcaagtcct ctgaggagaa gaagcctggt gagctcaaga gactagtgga aagtcgccga cagcagatct tgagggagtt tgaagagctt cataggcggc tggatgaaga gcagcaggtg ttgctttcac gactggaaga agaggaacag gacattctgc agcgactccg agaaaatgct gctcaccttg gggacaagcg ccgggacctg gcccacttgg ctgccgaggt ggagggcaag tgcttacagt caggcttcga gatgcttaag gatgtcaaaa gtaccctgga aaaatgtgaa aaggtgaaga ccatggaggt gacttcagta tccatagagc tggaaaagaa cttcagcaat tttccccgac agtactttgc cctaaggaaa atccttaaac agctaattgc ggatgtgacc ctggaccctg agacagctca tcctaaccta gtcctgtcag aggatcgtaa gagcgtcaag ttcgtggaga caagactccg ggatctccct gacacaccaa ggcgtttcac cttctaccct tgcgtcctgg ctactgaggg tttcacctca ggtcgacact actgggaggt ggaggtgggc gacaagaccc actgggcagt gggtgtatgc cgggactccg tgagccgaaa gggcgagttg actccactcc ctgagactgg ctactggcgg gtgcggctat ggaatgggga caaatatgca gccaccacca caccttttac ccctttgcac atcaaggtga aacccaagcg ggtaggcata ttcctagact atgaggccgg cacactgtct ttctacaatg tcacagaccg ctctcatatc tacaccttca ctgatacttt tactgagaaa ctttggcccc tcttctaccc aggcatccgg gctggacgga agaatgctgc accacttacc atcaggcccc caacagattg ggagtga. It is sometimes possible for the material contained within the vial of "TRIM39, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.