Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

IL1RN cdna clone

IL1RN cDNA Clone

Gene Names
IL1RN; DIRA; IRAP; IL1F3; IL1RA; MVCD4; IL-1RN; IL-1ra; IL-1ra3; ICIL-1RA
Synonyms
IL1RN; IL1RN cDNA Clone; IL1RN cdna clone
Ordering
For Research Use Only!
Sequence
atggctttagagacgatctgccgaccctctgggagaaaatccagcaagatgcaagccttcagaatctgggatgttaaccagaagaccttctatctgaggaacaaccaactagttgccggatacttgcaaggaccaaatgtcaatttagaagaaaagatagatgtggtacccattgagcctcatgctctgttcttgggaatccatggagggaagatgtgcctgtcctgtgtcaagtctggtgatgagaccagactccagctggaggcagttaacatcactgacctgagcgagaacagaaagcaggacaagcgcttcgccttcatccgctcagacagtggccccaccaccagttttgagtctgccgcctgccccggttggttcctctgcacagcgatggaagctgaccagcccgtcagcctcaccaatatgcctgacgaaggcgtcatggtcaccaaattctacttccaggaggacgagtag
Sequence Length
480
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
16,142 Da
NCBI Official Full Name
Homo sapiens interleukin 1 receptor antagonist, mRNA
NCBI Official Synonym Full Names
interleukin 1 receptor antagonist
NCBI Official Symbol
IL1RN
NCBI Official Synonym Symbols
DIRA; IRAP; IL1F3; IL1RA; MVCD4; IL-1RN; IL-1ra; IL-1ra3; ICIL-1RA
NCBI Protein Information
interleukin-1 receptor antagonist protein
UniProt Protein Name
Interleukin-1 receptor antagonist protein
UniProt Gene Name
IL1RN
UniProt Synonym Gene Names
IL1F3; IL1RA; IL-1RN; IL-1ra; IRAP
UniProt Entry Name
IL1RA_HUMAN

NCBI Description

The protein encoded by this gene is a member of the interleukin 1 cytokine family. This protein inhibits the activities of interleukin 1, alpha (IL1A) and interleukin 1, beta (IL1B), and modulates a variety of interleukin 1 related immune and inflammatory responses. This gene and five other closely related cytokine genes form a gene cluster spanning approximately 400 kb on chromosome 2. A polymorphism of this gene is reported to be associated with increased risk of osteoporotic fractures and gastric cancer. Several alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Jan 2016]

Uniprot Description

IL1RN: Inhibits the activity of interleukin-1 by binding to receptor IL1R1 and preventing its association with the coreceptor IL1RAP for signaling. Has no interleukin-1 like activity. Binds functional interleukin-1 receptor IL1R1 with greater affinity than decoy receptor IL1R2; however, the physiological relevance of the latter association is unsure. The intracellular form of IL1RN is predominantly expressed in epithelial cells. 4 isoforms of the human protein are produced by alternative splicing.

Protein type: Cytokine; Secreted, signal peptide; Vesicle; Secreted

Chromosomal Location of Human Ortholog: 2q14.2

Cellular Component: extracellular space; plasma membrane

Molecular Function: cytokine activity; interleukin-1 receptor antagonist activity; interleukin-1 Type I receptor antagonist activity; interleukin-1 Type II receptor antagonist activity; interleukin-1, Type I receptor binding; interleukin-1, Type II receptor binding; protein binding

Biological Process: negative regulation of heterotypic cell-cell adhesion; response to glucocorticoid stimulus

Disease: Gastric Cancer, Hereditary Diffuse; Microvascular Complications Of Diabetes, Susceptibility To, 4; Osteomyelitis, Sterile Multifocal, With Periostitis And Pustulosis

Research Articles on IL1RN

Similar Products

Product Notes

The IL1RN il1rn (Catalog #AAA1275933) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggctttag agacgatctg ccgaccctct gggagaaaat ccagcaagat gcaagccttc agaatctggg atgttaacca gaagaccttc tatctgagga acaaccaact agttgccgga tacttgcaag gaccaaatgt caatttagaa gaaaagatag atgtggtacc cattgagcct catgctctgt tcttgggaat ccatggaggg aagatgtgcc tgtcctgtgt caagtctggt gatgagacca gactccagct ggaggcagtt aacatcactg acctgagcga gaacagaaag caggacaagc gcttcgcctt catccgctca gacagtggcc ccaccaccag ttttgagtct gccgcctgcc ccggttggtt cctctgcaca gcgatggaag ctgaccagcc cgtcagcctc accaatatgc ctgacgaagg cgtcatggtc accaaattct acttccagga ggacgagtag. It is sometimes possible for the material contained within the vial of "IL1RN, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.