Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

TMIE cdna clone

TMIE cDNA Clone

Gene Names
TMIE; DFNB6
Synonyms
TMIE; TMIE cDNA Clone; TMIE cdna clone
Ordering
For Research Use Only!
Sequence
atggcggggtggccgggcgcgggtcccctctgcgtgctgggcggcgccgcactcggggtgtgcctcgcgggggttgccgggcagctggtggagcccagcacggccccacccaagcccaagccgcctccgctgaccaaggagacagtggtgttctgggacatgcgcctgtggcacgtggtgggcatcttttcgctcttcgtgttgtccatcatcatcacgctgtgctgtgtcttcaactgtcgtgtgccacggacccggaaggagatcgaagcccggtacctgcagcgaaaggcagccaagatgtacacagacaagctggagactgtgccacccctcaatgagctcacagaagtcccaggagaggataagaagaagaagaagaagaagaaggacagtgtggacacagtggccatcaaagtagaggaggatgagaagaatgaggccaagaagaagaaaggagagaaatga
Sequence Length
468
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
17,241 Da
NCBI Official Full Name
Homo sapiens transmembrane inner ear, mRNA
NCBI Official Synonym Full Names
transmembrane inner ear
NCBI Official Symbol
TMIE
NCBI Official Synonym Symbols
DFNB6
NCBI Protein Information
transmembrane inner ear expressed protein
UniProt Protein Name
Transmembrane inner ear expressed protein
UniProt Gene Name
TMIE
UniProt Entry Name
TMIE_HUMAN

NCBI Description

This gene encodes a transmembrane inner ear protein. Studies in mouse suggest that this gene is required for normal postnatal maturation of sensory hair cells in the cochlea, including correct development of stereocilia bundles. This gene is one of multiple genes responsible for recessive non-syndromic deafness (DFNB), also known as autosomal recessive nonsyndromic hearing loss (ARNSHL), the most common form of congenitally acquired inherited hearing impairment. [provided by RefSeq, Mar 2009]

Uniprot Description

TMIE: Unknown. The protein may play some role in a cellular membrane location. May reside within an internal membrane compartment and function in pathways such as those involved in protein and/or vesicle trafficking. Alternatively, the mature protein may be localized in the plasma membrane and serve as a site of interaction for other molecules through its highly charged C-terminal domain. Defects in TMIE are the cause of deafness autosomal recessive type 6 (DFNB6). DFNB6 is a form of sensorineural hearing loss. Sensorineural deafness results from damage to the neural receptors of the inner ear, the nerve pathways to the brain, or the area of the brain that receives sound information.

Protein type: Membrane protein, integral

Chromosomal Location of Human Ortholog: 3p21

Disease: Deafness, Autosomal Recessive 6

Research Articles on TMIE

Similar Products

Product Notes

The TMIE tmie (Catalog #AAA1275919) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcggggt ggccgggcgc gggtcccctc tgcgtgctgg gcggcgccgc actcggggtg tgcctcgcgg gggttgccgg gcagctggtg gagcccagca cggccccacc caagcccaag ccgcctccgc tgaccaagga gacagtggtg ttctgggaca tgcgcctgtg gcacgtggtg ggcatctttt cgctcttcgt gttgtccatc atcatcacgc tgtgctgtgt cttcaactgt cgtgtgccac ggacccggaa ggagatcgaa gcccggtacc tgcagcgaaa ggcagccaag atgtacacag acaagctgga gactgtgcca cccctcaatg agctcacaga agtcccagga gaggataaga agaagaagaa gaagaagaag gacagtgtgg acacagtggc catcaaagta gaggaggatg agaagaatga ggccaagaag aagaaaggag agaaatga. It is sometimes possible for the material contained within the vial of "TMIE, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.