Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

GNAI1 cdna clone

GNAI1 cDNA Clone

Gene Names
GNAI1; Gi
Synonyms
GNAI1; GNAI1 cDNA Clone; GNAI1 cdna clone
Ordering
For Research Use Only!
Sequence
atgggctgcacgctgagcgccgaggacaaggcggcggtggagcggagtaagatgatcgaccgcaacctccgtgaggacggcgagaaggcggcgcgcgaggtcaagctgctgctgctcggtgctggtgaatctggtaaaagtacaattgtgaagcagatgaaaattatccatgaagctggttattcagaagaggagtgtaaacaatacaaagcagtggtctacagtaacaccatccagtcaattattgctatcattagggctatggggaggttgaagatagactttggtgactcagcccgggcggatgatgcacgccaactctttgtgctagctggagctgctgaagaaggctttatgactgcagaacttgctggagttataaagagattgtggaaagatagtggtgtacaagcctgtttcaacagatcccgagagtaccagcttaatgattctgcagcatactatttgaatgacttggacagaatagctcaaccaaattacatcccgactcaacaagatgttctcagaactagagtgaaaactacaggaattgttgaaacccattttactttcaaagatcttcattttaaaatgtttgatgtgggaggtcagagatctgagcggaagaagtggattcattgcttcgaaggagtggcggcgatcatcttctgtgtagcactgagtgactacgacctggttctagctgaagatgaagaaatgaaccgaatgcatgaaagcatgaaattgtttgacagcatatgtaacaacaagtggtttacagatacatccattatactttttctaaacaagaaggatctttttgaagaaaaaatcaaaaagagccctctcactatatgctatcaagaatatgcaggatcaaacacatatgaagaggcagctgcatatattcaatgtcagtttgaagacctcaataaaagaaaggacacaaaggaaatatacacccacttcacatgtgccacagatactaagaatgtgcagtttgtttttgatgctgtaacagatgtcatcataaaaaataatctaaaagattgtggtctcttttaa
Sequence Length
1065
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
34,775 Da
NCBI Official Full Name
Homo sapiens guanine nucleotide binding protein (G protein), alpha inhibiting activity polypeptide 1, mRNA
NCBI Official Synonym Full Names
G protein subunit alpha i1
NCBI Official Symbol
GNAI1
NCBI Official Synonym Symbols
Gi
NCBI Protein Information
guanine nucleotide-binding protein G(i) subunit alpha-1
UniProt Protein Name
Guanine nucleotide-binding protein G(i) subunit alpha-1
UniProt Gene Name
GNAI1
UniProt Entry Name
GNAI1_HUMAN

NCBI Description

Guanine nucleotide binding proteins are heterotrimeric signal-transducing molecules consisting of alpha, beta, and gamma subunits. The alpha subunit binds guanine nucleotide, can hydrolyze GTP, and can interact with other proteins. The protein encoded by this gene represents the alpha subunit of an inhibitory complex. The encoded protein is part of a complex that responds to beta-adrenergic signals by inhibiting adenylate cyclase. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]

Uniprot Description

G-alpha i1: Guanine nucleotide-binding proteins (G proteins) are involved as modulators or transducers in various transmembrane signaling systems. The G(i) proteins are involved in hormonal regulation of adenylate cyclase: they inhibit the cyclase in response to beta-adrenergic stimuli. The inactive GDP-bound form prevents the association of RGS14 with centrosomes and is required for the translocation of RGS14 from the cytoplasm to the plasma membrane. May play a role in cell division. Interacts with GPSM1. Interacts with RGS12. Interacts (via active GTP- or inactive GDP-bound forms) with RGS14 (via RGS and GoLoco domains); the interaction occurs in the centrosomes. Interacts (GDP-bound form) with RIC8A (via C-terminus). Interacts with DRD2. G proteins are composed of 3 units; alpha, beta and gamma. The alpha chain contains the guanine nucleotide binding site. Belongs to the G-alpha family. G(i/o/t/z) subfamily.

Protein type: G protein; G protein, heterotrimeric; G protein, heterotrimeric alpha G((i/o/t/z))

Chromosomal Location of Human Ortholog: 7q21

Cellular Component: centrosome; cytoplasm; heterotrimeric G-protein complex; lysosomal membrane; midbody; plasma membrane

Molecular Function: G-protein beta/gamma-subunit binding; G-protein-coupled receptor binding; GDP binding; GTP binding; GTPase activity; magnesium ion binding; metabotropic serotonin receptor binding; protein binding; signal transducer activity

Biological Process: cell division; G-protein coupled receptor protein signaling pathway; G-protein signaling, adenylate cyclase inhibiting pathway; G-protein signaling, coupled to cAMP nucleotide second messenger; protein folding; response to peptide hormone stimulus

Research Articles on GNAI1

Similar Products

Product Notes

The GNAI1 gnai1 (Catalog #AAA1275890) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgggctgca cgctgagcgc cgaggacaag gcggcggtgg agcggagtaa gatgatcgac cgcaacctcc gtgaggacgg cgagaaggcg gcgcgcgagg tcaagctgct gctgctcggt gctggtgaat ctggtaaaag tacaattgtg aagcagatga aaattatcca tgaagctggt tattcagaag aggagtgtaa acaatacaaa gcagtggtct acagtaacac catccagtca attattgcta tcattagggc tatggggagg ttgaagatag actttggtga ctcagcccgg gcggatgatg cacgccaact ctttgtgcta gctggagctg ctgaagaagg ctttatgact gcagaacttg ctggagttat aaagagattg tggaaagata gtggtgtaca agcctgtttc aacagatccc gagagtacca gcttaatgat tctgcagcat actatttgaa tgacttggac agaatagctc aaccaaatta catcccgact caacaagatg ttctcagaac tagagtgaaa actacaggaa ttgttgaaac ccattttact ttcaaagatc ttcattttaa aatgtttgat gtgggaggtc agagatctga gcggaagaag tggattcatt gcttcgaagg agtggcggcg atcatcttct gtgtagcact gagtgactac gacctggttc tagctgaaga tgaagaaatg aaccgaatgc atgaaagcat gaaattgttt gacagcatat gtaacaacaa gtggtttaca gatacatcca ttatactttt tctaaacaag aaggatcttt ttgaagaaaa aatcaaaaag agccctctca ctatatgcta tcaagaatat gcaggatcaa acacatatga agaggcagct gcatatattc aatgtcagtt tgaagacctc aataaaagaa aggacacaaa ggaaatatac acccacttca catgtgccac agatactaag aatgtgcagt ttgtttttga tgctgtaaca gatgtcatca taaaaaataa tctaaaagat tgtggtctct tttaa. It is sometimes possible for the material contained within the vial of "GNAI1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.