Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CARD14 cdna clone

CARD14 cDNA Clone

Gene Names
CARD14; PRP; PSS1; BIMP2; CARMA2; PSORS2
Synonyms
CARD14; CARD14 cDNA Clone; CARD14 cdna clone
Ordering
For Research Use Only!
Sequence
atgggggaactgtgccgcagggactccgcactcacggcactggacgaggagacactgtgggagatgatggagagccaccgccacaggatcgtacgctgcatctgccccagccgcctcaccccctacctgcgccaggccaaggtgctgtgccagctggacgaggaggaggtgctgcacagcccccggctcaccaacagcgccatgcgggccgggcacttgctggatttgctgaagactcgagggaagaacggggccatcgccttcctggagagcctgaagttccacaaccctgacgtctacaccctggtcaccgggctgcagcctgatgttgacttcagtaactttagcggtctcatggagacatccaagctgaccgagtgcctggctggggccatcggcagcctgcaggaggagctgaaccaggaaaaggggcagaaggaggtgctgctgcggcggtgccagcagctgcaggagcacctgggcctggccgagacccgtgccgagggcctgcaccagctggaggctgaccacagccgcatgaagcgtgaggttagcgcacacttccatgaggtgctgaggctgaaggacgagatgctcagcctctcgctgcactatagcaatgcgctgcaggaaaaggagctggccgcctcacgctgccgcagcctgcaggaggagctgtatctactgaagcaggagctgcagcgagccaacatggtttcctcctgtgagctggaattgcaagagcagtccctgaggacagccagcgaccaggagtccggggatgaggagctgaaccgcctgaaggaggagaatgagaaactgcgctcgctgactttcagcctggcggagaaggacattctggagcagagcctggacgaggcgcgggggagccgacaggagctggtggagcgcatccactcgctgcgggagcgggccgtggctgccgagaggcagcgagagcagtactgggaagagaaggaacagaccctgctgcagttccagaagagtaagatggcctgccaactctacagggagaaggtgaatgcgctgcaggcccaggtgtgcgagctgcagaaggagcgagaccaggcgtactccgcgagggacagtgctcagagggagatttcccagagcctggtggagaaggactccctccgcaggcaggtgttcgagctgacggaccaggtctgcgagctgcgcacacagcttcgccagctgcaggcagagcctccgggtgtgctcaagcaggaagccaggaccagggagccctgtccacgggagaagcagcggctggtgcggatgcatgccatctgccccagagacgacagcgactgcagcctcgtcagctccacagagtctcagctcttgtcggacctgagtgccacgtccagccgcgagctggtggacagcttccgctccagcagccccgcgccccccagccagcagtccctgtacaagcgggtggccgaggacttcggggaagaaccctggtctttcagcagctgcctggagatcccggagggagacccgggagccctgccgggagctaaggcaggcgacccacacctggattatgagctcctagacacggcagaccttccgcagctggaaagcagcctgcagccagtctcccctggaaggcttgatgtctcggagagcggcgtcctcatgcggcggaggccagcccgcaggatcctgagccaggtcaccatgctggcgttccagggggatgcattgctggagcagatcagcgtcatcggcgggaacctcacgggcatcttcatccaccgggtcaccccgggctcggcggcggaccagatggccttgcgcccgggcacccagattgtgatggttgattacgaagcctcagagcccttgttcaaggcagtcctggaggacacgaccctggaggaggccgtggggcttctcaggagggtggacggcttctgctgcctgtctgtgaaggtcaacacggacggttataagaggctactccaggacctggaggccaaagtggcgacctcgggggactcattctacatccgggtcaacctggccatggagggcagggccaaaggggagctgcaggtgcattgcaacgaggtcctgcacgtcaccgacaccatgttccagggctgcggctgctggcatgcccaccgcgtgaactcttacaccatgaaggatactgccgcgcacggcaccatccccaactactccaggtga
Sequence Length
2223
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
48,505 Da
NCBI Official Full Name
Homo sapiens caspase recruitment domain family, member 14, mRNA
NCBI Official Synonym Full Names
caspase recruitment domain family member 14
NCBI Official Symbol
CARD14
NCBI Official Synonym Symbols
PRP; PSS1; BIMP2; CARMA2; PSORS2
NCBI Protein Information
caspase recruitment domain-containing protein 14
UniProt Protein Name
Caspase recruitment domain-containing protein 14
UniProt Gene Name
CARD14
UniProt Synonym Gene Names
CARMA2; Carma 2
UniProt Entry Name
CAR14_HUMAN

NCBI Description

This gene encodes a caspase recruitment domain-containing protein that is a member of the membrane-associated guanylate kinase (MAGUK) family of proteins. Members of this protein family are scaffold proteins that are involved in a diverse array of cellular processes including cellular adhesion, signal transduction and cell polarity control. This protein has been shown to specifically interact with BCL10, a protein known to function as a positive regulator of cell apoptosis and NF-kappaB activation. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Apr 2012]

Uniprot Description

CARD14: a protein containing a caspase recruitment domain (CARD) that functions as an activator of BCL10 and NF-kappaB signaling. CARD is a protein module that consists of 6 or 7 antiparallel alpha helices. It participates in signaling through highly specific protein-protein homophilic interactions. CARD proteins function as scaffolds for the assembly of multiprotein complexes at specialized regions of the plasma membrane. The CARD domain of CARD14 associates specifically with the CARD domains of CARD10 and BCL10, a signaling protein that activates NF-kB through the IkappaB kinase complex in response to upstream stimuli. When expressed in cells, CARD14 activates NF-kappaB and induces the phosphorylation of BCL10. A subgroup of primary lymphomas of the central nervous system have higher levels of CARD14 expression.

Protein type: Adaptor/scaffold

Chromosomal Location of Human Ortholog: 17q25

Cellular Component: cytoplasm

Molecular Function: CARD domain binding

Biological Process: activation of NF-kappaB transcription factor; negative regulation of apoptosis; positive regulation of protein amino acid phosphorylation; tumor necrosis factor-mediated signaling pathway

Disease: Pityriasis Rubra Pilaris; Psoriasis 2

Research Articles on CARD14

Similar Products

Product Notes

The CARD14 card14 (Catalog #AAA1275810) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgggggaac tgtgccgcag ggactccgca ctcacggcac tggacgagga gacactgtgg gagatgatgg agagccaccg ccacaggatc gtacgctgca tctgccccag ccgcctcacc ccctacctgc gccaggccaa ggtgctgtgc cagctggacg aggaggaggt gctgcacagc ccccggctca ccaacagcgc catgcgggcc gggcacttgc tggatttgct gaagactcga gggaagaacg gggccatcgc cttcctggag agcctgaagt tccacaaccc tgacgtctac accctggtca ccgggctgca gcctgatgtt gacttcagta actttagcgg tctcatggag acatccaagc tgaccgagtg cctggctggg gccatcggca gcctgcagga ggagctgaac caggaaaagg ggcagaagga ggtgctgctg cggcggtgcc agcagctgca ggagcacctg ggcctggccg agacccgtgc cgagggcctg caccagctgg aggctgacca cagccgcatg aagcgtgagg ttagcgcaca cttccatgag gtgctgaggc tgaaggacga gatgctcagc ctctcgctgc actatagcaa tgcgctgcag gaaaaggagc tggccgcctc acgctgccgc agcctgcagg aggagctgta tctactgaag caggagctgc agcgagccaa catggtttcc tcctgtgagc tggaattgca agagcagtcc ctgaggacag ccagcgacca ggagtccggg gatgaggagc tgaaccgcct gaaggaggag aatgagaaac tgcgctcgct gactttcagc ctggcggaga aggacattct ggagcagagc ctggacgagg cgcgggggag ccgacaggag ctggtggagc gcatccactc gctgcgggag cgggccgtgg ctgccgagag gcagcgagag cagtactggg aagagaagga acagaccctg ctgcagttcc agaagagtaa gatggcctgc caactctaca gggagaaggt gaatgcgctg caggcccagg tgtgcgagct gcagaaggag cgagaccagg cgtactccgc gagggacagt gctcagaggg agatttccca gagcctggtg gagaaggact ccctccgcag gcaggtgttc gagctgacgg accaggtctg cgagctgcgc acacagcttc gccagctgca ggcagagcct ccgggtgtgc tcaagcagga agccaggacc agggagccct gtccacggga gaagcagcgg ctggtgcgga tgcatgccat ctgccccaga gacgacagcg actgcagcct cgtcagctcc acagagtctc agctcttgtc ggacctgagt gccacgtcca gccgcgagct ggtggacagc ttccgctcca gcagccccgc gccccccagc cagcagtccc tgtacaagcg ggtggccgag gacttcgggg aagaaccctg gtctttcagc agctgcctgg agatcccgga gggagacccg ggagccctgc cgggagctaa ggcaggcgac ccacacctgg attatgagct cctagacacg gcagaccttc cgcagctgga aagcagcctg cagccagtct cccctggaag gcttgatgtc tcggagagcg gcgtcctcat gcggcggagg ccagcccgca ggatcctgag ccaggtcacc atgctggcgt tccaggggga tgcattgctg gagcagatca gcgtcatcgg cgggaacctc acgggcatct tcatccaccg ggtcaccccg ggctcggcgg cggaccagat ggccttgcgc ccgggcaccc agattgtgat ggttgattac gaagcctcag agcccttgtt caaggcagtc ctggaggaca cgaccctgga ggaggccgtg gggcttctca ggagggtgga cggcttctgc tgcctgtctg tgaaggtcaa cacggacggt tataagaggc tactccagga cctggaggcc aaagtggcga cctcggggga ctcattctac atccgggtca acctggccat ggagggcagg gccaaagggg agctgcaggt gcattgcaac gaggtcctgc acgtcaccga caccatgttc cagggctgcg gctgctggca tgcccaccgc gtgaactctt acaccatgaa ggatactgcc gcgcacggca ccatccccaa ctactccagg tga. It is sometimes possible for the material contained within the vial of "CARD14, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.