Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

DDX11 cdna clone

DDX11 cDNA Clone

Gene Names
DDX11; CHL1; KRG2; WABS; CHLR1
Synonyms
DDX11; DDX11 cDNA Clone; DDX11 cdna clone
Ordering
For Research Use Only!
Sequence
atggctaatgaaacacagaaggttggtgccatccattttccttttcccttcacaccctattccatccaggaagacttcatggcagagctgtaccgggttttggaggctggcaagattgggatatttgagagtccaactggcactgggaagtccttaagtcttatttgtggggccctctcttggctccgtgactttgaacagaagaagcgtgaagaagaggcacgactccttgaaactggaactggccccttacatgatgagaaagatgaatccctgtgtctgtcttcttcctgcgaaggggctgcaggcaccccgaggcctgctggagaaccggcctgggttactcagtttgtgcagaagaaagaagagagggacctggtggaccgactaaaggcggagcaggccaggaggaagcagcgagaagaacgcctgcagcagctgcagcacagggtgcagctcaagtatgcagccaagcgcctgaggcaggaagaagaagaaagagagaatctcctccgcctcagcagggagatgctagagacaggcccggaggctgagcggctggagcagctggagtctggggaggaggagctggtcctcgccgaatacgagagtgatgaggagaaaaaggtggcgagcagagtggatgaggatgaggatgacctggaggaagaacacataactaagatttattactgtagtcggacacactcccagctggcccagtttgtgcatgaggtgaagaagagcccctttggcaaggatgttcggctggtctcccttggctcccggcagaacctttgtgtaaatgaagacgtgaaaagcctaggttctgtgcagcttatcaacgaccgctgtgtggacatgcagagaagcaggcacgagaagaagaaaggagctgaggaggagaagccaaagaggaggaggcaggagaagcaggcagcctgccccttctacaaccacgagcagatgggccttctccgggatgaggccctggcagaggtgaaggacatggagcagctgctggcccttgggaaggaggcccgggcctgtccctattacgggagccgccttgccatccctgcagcccagctggtggtgctgccctatcagatgctgctgcatgcggccactcggcaggccgcgggcatccggctgcaggaccaggtggtgatcatcgacgaggcgcacaacctgatcgacaccatcacgggcatgcacagcgtggaggtcagcggctcccagctctgccaggcccattcccagctgctgcagtacgtggagcgatacgggaagcgtttgaaggccaagaacctgatgtacctgaagcagatcctgtatttgctggagaaattcgtggctgtgctaggggggaacattaagcaaaatcccaatacacagagtctgtcacagacagggacggagctgaagaccatcaacgactttctcttccagagccagatcgacaacatcaacctgttcaaggtgcagcgatactgtgagaagagcatgatcagcagaaagctctttggattcactgaacggtacggagcagtgttctcatcccgggagcagcccaaactggctgggtttcagcaattcctgcagagcctgcagcccaggacgactgaagctcttgcagcccctgcagacgagagtcaggccagcaccctgcgaccagcttctccactgatgcacatccaaggcttcctggcagctctcactacggccaaccaggacggcagggtcatcctgagccgccaaggcagcctcagtcagagcaccctgaagtttttgctcctgaatccagctgtgcactttgcccaagtggtgaaggaatgccgggcagtggtcattgcggggggtaccatgcagccggtgtctgacttccggcagcagctgctggcctgtgccggggtggaagctgagcgcgtggtggagttttcctgtggtcacgtgatccctccagacaacatcctgcccctcgtcatctgcagcgggatctccaaccagccgctggaattcacgttccagaaaagagagctgcctcagatgatggacgaggtgggtcgcattctctgtaacctgtgcggtgtggttcctggaggggtggtctgtttcttcccctcctacgagtacctgcgccaggtccatgcccactgggagaagggtggcctgctgggccgtctggctgccaggaagaagatattccaggaacctaagagcgcacaccaggtggagcaggtgctgctggcatattccaggtgcatccaggcctgtggccaggagagaggccaggtgacaggggccctgctcctctctgtggttggaggaaagatgagtgaagggatcaacttctctgacaacctaggccggtgtgtggtgatggtgggcatgcccttccccaacatcaggtctgcagagctgcaggagaagatggcctacttggatcaaaccctcagcccccggccaggcacccccagggaaggctctggtggagaacctgtgcatgaaggccgtcaaccagtccataggcagggccatcaggcaccagaaggattttgccagcgtagtgctcctggaccagcgatatgcccggccccctgtcctggccaagctgccggcctggatccgagcccgtgtggaggtcaaagctacctttggccccgccattgctgctgtgcagaagtttcaccgggagaagtcggcctcttcctgatgggcaaccacaccactgcctggcgccgtgcccttcctttgtcctgcccgctggagacagtgtttgtcgtgggcgtggtctgcggggatcctgttacaaaggtgaaacccaggaggagagtgtggagtccagagtgctgccaggacccaggcacaggcgttagctcccgtaggagaaaatgggggaatcctgaatga
Sequence Length
2913
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
32,951 Da
NCBI Official Full Name
Homo sapiens DEAD/H (Asp-Glu-Ala-Asp/His) box polypeptide 11 (CHL1-like helicase homolog, S. cerevisiae), mRNA
NCBI Official Synonym Full Names
DEAD/H-box helicase 11
NCBI Official Symbol
DDX11
NCBI Official Synonym Symbols
CHL1; KRG2; WABS; CHLR1
NCBI Protein Information
probable ATP-dependent DNA helicase DDX11
UniProt Protein Name
Probable ATP-dependent DNA helicase DDX11
UniProt Gene Name
DDX11
UniProt Synonym Gene Names
CHL1; CHLR1; KRG2; hCHLR1; KRG-2
UniProt Entry Name
DDX11_HUMAN

NCBI Description

DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a DEAD box protein, which is an enzyme that possesses both ATPase and DNA helicase activities. This gene is a homolog of the yeast CHL1 gene, and may function to maintain chromosome transmission fidelity and genome stability. Alternative splicing results in multiple transcript variants encoding distinct isoforms. [provided by RefSeq, Jul 2008]

Uniprot Description

DDX11: DNA helicase involved in cellular proliferation. Possesses DNA-dependent ATPase and helicase activities. This helicase translocates on single-stranded DNA in the 5' to 3' direction in the presence of ATP and, to a lesser extent, dATP. Its unwinding activity requires a 5'-single-stranded region for helicase loading, since flush-ended duplex structures do not support unwinding. The helicase activity is capable of displacing duplex regions up to 100 bp, which can be extended to 500 bp by RPA or the cohesion establishment factor, the Ctf18-RFC (replication factor C) complex activities. Stimulates the flap endonuclease activity of FEN1. Required for normal sister chromatid cohesion. Required for recruitment of bovine papillomavirus type 1 regulatory protein E2 to mitotic chrmosomes and for viral genome maintenance. Required for maintaining the chromosome segregation and is essential for embryonic development and the prevention of aneuploidy. May function during either S, G2, or M phase of the cell cycle. Binds to both single- and double-stranded DNA. Defects in DDX11 are the cause of Warsaw breakage syndrome (WBRS). It is a syndrome characterized by severe microcephaly, pre- and postnatal growth retardation, facial dysmorphism and abnormal skin pigmentation. Additional features include high arched palate, coloboma of the right optic disk, deafness, ventricular septal defect, toes and fingers abnormalities. At cellular level, drug-induced chromosomal breakage, a feature of Fanconi anemia, and sister chromatid cohesion defects, a feature of Roberts syndrome, coexist. Belongs to the DEAD box helicase family. DEAH subfamily. DDX11/CHL1 sub-subfamily. 5 isoforms of the human protein are produced by alternative splicing.

Protein type: Nucleolus; EC 3.6.4.13; Helicase

Chromosomal Location of Human Ortholog: 12p11

Cellular Component: midbody; nuclear chromatin; nucleolus; nucleoplasm; nucleus; spindle pole

Molecular Function: DNA-dependent ATPase activity; double-stranded DNA binding; helicase activity; protein binding; single-stranded DNA binding

Biological Process: sister chromatid cohesion

Disease: Warsaw Breakage Syndrome

Research Articles on DDX11

Similar Products

Product Notes

The DDX11 ddx11 (Catalog #AAA1275721) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggctaatg aaacacagaa ggttggtgcc atccattttc cttttccctt cacaccctat tccatccagg aagacttcat ggcagagctg taccgggttt tggaggctgg caagattggg atatttgaga gtccaactgg cactgggaag tccttaagtc ttatttgtgg ggccctctct tggctccgtg actttgaaca gaagaagcgt gaagaagagg cacgactcct tgaaactgga actggcccct tacatgatga gaaagatgaa tccctgtgtc tgtcttcttc ctgcgaaggg gctgcaggca ccccgaggcc tgctggagaa ccggcctggg ttactcagtt tgtgcagaag aaagaagaga gggacctggt ggaccgacta aaggcggagc aggccaggag gaagcagcga gaagaacgcc tgcagcagct gcagcacagg gtgcagctca agtatgcagc caagcgcctg aggcaggaag aagaagaaag agagaatctc ctccgcctca gcagggagat gctagagaca ggcccggagg ctgagcggct ggagcagctg gagtctgggg aggaggagct ggtcctcgcc gaatacgaga gtgatgagga gaaaaaggtg gcgagcagag tggatgagga tgaggatgac ctggaggaag aacacataac taagatttat tactgtagtc ggacacactc ccagctggcc cagtttgtgc atgaggtgaa gaagagcccc tttggcaagg atgttcggct ggtctccctt ggctcccggc agaacctttg tgtaaatgaa gacgtgaaaa gcctaggttc tgtgcagctt atcaacgacc gctgtgtgga catgcagaga agcaggcacg agaagaagaa aggagctgag gaggagaagc caaagaggag gaggcaggag aagcaggcag cctgcccctt ctacaaccac gagcagatgg gccttctccg ggatgaggcc ctggcagagg tgaaggacat ggagcagctg ctggcccttg ggaaggaggc ccgggcctgt ccctattacg ggagccgcct tgccatccct gcagcccagc tggtggtgct gccctatcag atgctgctgc atgcggccac tcggcaggcc gcgggcatcc ggctgcagga ccaggtggtg atcatcgacg aggcgcacaa cctgatcgac accatcacgg gcatgcacag cgtggaggtc agcggctccc agctctgcca ggcccattcc cagctgctgc agtacgtgga gcgatacggg aagcgtttga aggccaagaa cctgatgtac ctgaagcaga tcctgtattt gctggagaaa ttcgtggctg tgctaggggg gaacattaag caaaatccca atacacagag tctgtcacag acagggacgg agctgaagac catcaacgac tttctcttcc agagccagat cgacaacatc aacctgttca aggtgcagcg atactgtgag aagagcatga tcagcagaaa gctctttgga ttcactgaac ggtacggagc agtgttctca tcccgggagc agcccaaact ggctgggttt cagcaattcc tgcagagcct gcagcccagg acgactgaag ctcttgcagc ccctgcagac gagagtcagg ccagcaccct gcgaccagct tctccactga tgcacatcca aggcttcctg gcagctctca ctacggccaa ccaggacggc agggtcatcc tgagccgcca aggcagcctc agtcagagca ccctgaagtt tttgctcctg aatccagctg tgcactttgc ccaagtggtg aaggaatgcc gggcagtggt cattgcgggg ggtaccatgc agccggtgtc tgacttccgg cagcagctgc tggcctgtgc cggggtggaa gctgagcgcg tggtggagtt ttcctgtggt cacgtgatcc ctccagacaa catcctgccc ctcgtcatct gcagcgggat ctccaaccag ccgctggaat tcacgttcca gaaaagagag ctgcctcaga tgatggacga ggtgggtcgc attctctgta acctgtgcgg tgtggttcct ggaggggtgg tctgtttctt cccctcctac gagtacctgc gccaggtcca tgcccactgg gagaagggtg gcctgctggg ccgtctggct gccaggaaga agatattcca ggaacctaag agcgcacacc aggtggagca ggtgctgctg gcatattcca ggtgcatcca ggcctgtggc caggagagag gccaggtgac aggggccctg ctcctctctg tggttggagg aaagatgagt gaagggatca acttctctga caacctaggc cggtgtgtgg tgatggtggg catgcccttc cccaacatca ggtctgcaga gctgcaggag aagatggcct acttggatca aaccctcagc ccccggccag gcacccccag ggaaggctct ggtggagaac ctgtgcatga aggccgtcaa ccagtccata ggcagggcca tcaggcacca gaaggatttt gccagcgtag tgctcctgga ccagcgatat gcccggcccc ctgtcctggc caagctgccg gcctggatcc gagcccgtgt ggaggtcaaa gctacctttg gccccgccat tgctgctgtg cagaagtttc accgggagaa gtcggcctct tcctgatggg caaccacacc actgcctggc gccgtgccct tcctttgtcc tgcccgctgg agacagtgtt tgtcgtgggc gtggtctgcg gggatcctgt tacaaaggtg aaacccagga ggagagtgtg gagtccagag tgctgccagg acccaggcac aggcgttagc tcccgtagga gaaaatgggg gaatcctgaa tga. It is sometimes possible for the material contained within the vial of "DDX11, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.