Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

GATA1 cdna clone

GATA1 cDNA Clone

Gene Names
GATA1; GF1; GF-1; NFE1; XLTT; ERYF1; NF-E1; XLANP; XLTDA; GATA-1
Synonyms
GATA1; GATA1 cDNA Clone; GATA1 cdna clone
Ordering
For Research Use Only!
Sequence
atggagttccctggcctggggtccctggggacctcagagcccctcccccagtttgtggatcctgctctggtgtcctccacaccagaatcaggggttttcttcccctctgggcctgagggcttggatgcagcagcttcctccactgccccgagcacagccaccgctgcagctgcggcactggcctactacagggacgctgaggcctacagacactccccagtctttcaggtgtacccattgctcaactgtatggaggggatcccagggggctcaccatatgccggctgggcctacggcaagacggggctctaccctgcctcaactgtgtgtcccacccgcgaggactctcctccccaggccgtggaagatctggatggaaaaggcagcaccagcttcctggagactttgaagacagagcggctgagcccagacctcctgaccctgggacctgcactgccttcatcactccctgtccccaatagtgcttatgggggccctgacttttccagtaccttcttttctcccaccgggagccccctcaattcagcagcctattcctctcccaagcttcgtggaactctccccctgcctccctgtgaggccagggagtgtgtgaactgcggagcaacagccactccactgtggcggagggacaggacaggccactacctatgcaacgcctgcggcctctatcacaagatgaatgggcagaacaggcccctcatccggcccaagaagcgcctgattgtcagtaaacgggcaggtactcagtgcaccaactgccagacgaccaccacgacactgtggcggagaaatgccagtggggatcccgtgtgcaatgcctgcggcctctactacaagctacaccaccagcactactgtggtggctccgctcagctcatgagggcacagagcatggcctccagaggaggggtggtgtccttctcctcttgtagccagaattctggacaacccaagtctctgggccccaggcaccccctggcttga
Sequence Length
1008
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
34,232 Da
NCBI Official Full Name
Homo sapiens GATA binding protein 1 (globin transcription factor 1), mRNA
NCBI Official Synonym Full Names
GATA binding protein 1
NCBI Official Symbol
GATA1
NCBI Official Synonym Symbols
GF1; GF-1; NFE1; XLTT; ERYF1; NF-E1; XLANP; XLTDA; GATA-1
NCBI Protein Information
erythroid transcription factor
UniProt Protein Name
Erythroid transcription factor
Protein Family
UniProt Gene Name
GATA1
UniProt Synonym Gene Names
ERYF1; GF1; GATA-1; GF-1
UniProt Entry Name
GATA1_HUMAN

NCBI Description

This gene encodes a protein which belongs to the GATA family of transcription factors. The protein plays an important role in erythroid development by regulating the switch of fetal hemoglobin to adult hemoglobin. Mutations in this gene have been associated with X-linked dyserythropoietic anemia and thrombocytopenia. [provided by RefSeq, Jul 2008]

Uniprot Description

GATA1: Transcriptional activator which probably serves as a general switch factor for erythroid development. It binds to DNA sites with the consensus sequence [AT]GATA[AG] within regulatory regions of globin genes and of other genes expressed in erythroid cells. May form homodimers or heterodimers with other isoforms. Interacts (via the N-terminal zinc finger) with ZFPM1. Interacts with GFI1B. Interacts with PIAS4; the interaction enhances sumoylation and represses the transactivational activity in a sumoylation-independent manner. Interacts with LMCD1. Interacts with CREBBP; the interaction stimulates acetylation and transcriptional activity in vivo. Interacts with EP300. Erythrocytes. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: Transcription factor; DNA-binding

Chromosomal Location of Human Ortholog: Xp11.23

Cellular Component: nucleoplasm; nucleus; transcription factor complex; transcriptional repressor complex

Molecular Function: chromatin DNA binding; DNA binding; protein binding; sequence-specific DNA binding; transcription factor activity

Biological Process: basophil differentiation; blood coagulation; eosinophil differentiation; erythrocyte development; erythrocyte differentiation; gut development; heart development; male gonad development; megakaryocyte differentiation; negative regulation of apoptosis; negative regulation of transcription from RNA polymerase II promoter; organ morphogenesis; platelet formation; positive regulation of erythrocyte differentiation; positive regulation of peptidyl-tyrosine phosphorylation; positive regulation of transcription from RNA polymerase II promoter; positive regulation of transcription, DNA-dependent; tissue development; transcription from RNA polymerase II promoter

Disease: Anemia, X-linked, With Or Without Neutropenia And/or Platelet Abnormalities; Down Syndrome; Thrombocytopenia With Beta-thalassemia, X-linked; Thrombocytopenia, X-linked, With Or Without Dyserythropoietic Anemia

Research Articles on GATA1

Similar Products

Product Notes

The GATA1 gata1 (Catalog #AAA1275712) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggagttcc ctggcctggg gtccctgggg acctcagagc ccctccccca gtttgtggat cctgctctgg tgtcctccac accagaatca ggggttttct tcccctctgg gcctgagggc ttggatgcag cagcttcctc cactgccccg agcacagcca ccgctgcagc tgcggcactg gcctactaca gggacgctga ggcctacaga cactccccag tctttcaggt gtacccattg ctcaactgta tggaggggat cccagggggc tcaccatatg ccggctgggc ctacggcaag acggggctct accctgcctc aactgtgtgt cccacccgcg aggactctcc tccccaggcc gtggaagatc tggatggaaa aggcagcacc agcttcctgg agactttgaa gacagagcgg ctgagcccag acctcctgac cctgggacct gcactgcctt catcactccc tgtccccaat agtgcttatg ggggccctga cttttccagt accttctttt ctcccaccgg gagccccctc aattcagcag cctattcctc tcccaagctt cgtggaactc tccccctgcc tccctgtgag gccagggagt gtgtgaactg cggagcaaca gccactccac tgtggcggag ggacaggaca ggccactacc tatgcaacgc ctgcggcctc tatcacaaga tgaatgggca gaacaggccc ctcatccggc ccaagaagcg cctgattgtc agtaaacggg caggtactca gtgcaccaac tgccagacga ccaccacgac actgtggcgg agaaatgcca gtggggatcc cgtgtgcaat gcctgcggcc tctactacaa gctacaccac cagcactact gtggtggctc cgctcagctc atgagggcac agagcatggc ctccagagga ggggtggtgt ccttctcctc ttgtagccag aattctggac aacccaagtc tctgggcccc aggcaccccc tggcttga. It is sometimes possible for the material contained within the vial of "GATA1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.