Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

COX4I1 cdna clone

COX4I1 cDNA Clone

Gene Names
COX4I1; COX4; COXIV; COX4-1; COXIV-1; COX IV-1
Synonyms
COX4I1; COX4I1 cDNA Clone; COX4I1 cdna clone
Ordering
For Research Use Only!
Sequence
atgttggctaccagggtatttagcctagttggcaagcgagcaatttccacctctgtgtgtgtacgagctcatgaaagtgttgtgaagagcgaagacttttcgctcccagcttatatggatcggcgtgaccaccccttgccggaggtggcccatgtcaagcacctgtctgccagccagaaggcactgaaggagaaggagaaggcctcctggagcagcctctccatggatgagaaagtcgagttgtatcgcattaagttcaaggagagctttgctgagatgaacaggggctcgaacgagtggaagacggttgtgggcggtgccatgttcttcatcggtttcaccgcgctcgttatcatgtggcagaagcactatgtgtacggccccctcccgcaaagctttgacaaagagtgggtggccaagcagaccaagaggatgctggacatgaaggtgaaccccatccagggcttagcctccaagtgggactacgaaaagaacgagtggaagaagtga
Sequence Length
510
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
19,577 Da
NCBI Official Full Name
Homo sapiens cytochrome c oxidase subunit IV isoform 1, mRNA
NCBI Official Synonym Full Names
cytochrome c oxidase subunit 4I1
NCBI Official Symbol
COX4I1
NCBI Official Synonym Symbols
COX4; COXIV; COX4-1; COXIV-1; COX IV-1
NCBI Protein Information
cytochrome c oxidase subunit 4 isoform 1, mitochondrial
UniProt Protein Name
Cytochrome c oxidase subunit 4 isoform 1, mitochondrial
Protein Family
UniProt Gene Name
COX4I1
UniProt Synonym Gene Names
COX4; COX IV-1
UniProt Entry Name
COX41_HUMAN

NCBI Description

Cytochrome c oxidase (COX) is the terminal enzyme of the mitochondrial respiratory chain. It is a multi-subunit enzyme complex that couples the transfer of electrons from cytochrome c to molecular oxygen and contributes to a proton electrochemical gradient across the inner mitochondrial membrane. The complex consists of 13 mitochondrial- and nuclear-encoded subunits. The mitochondrially-encoded subunits perform the electron transfer and proton pumping activities. The functions of the nuclear-encoded subunits are unknown but they may play a role in the regulation and assembly of the complex. This gene encodes the nuclear-encoded subunit IV isoform 1 of the human mitochondrial respiratory chain enzyme. It is located at the 3' of the NOC4 (neighbor of COX4) gene in a head-to-head orientation, and shares a promoter with it. Pseudogenes related to this gene are located on chromosomes 13 and 14. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jan 2016]

Uniprot Description

COX4I1: This protein is one of the nuclear-coded polypeptide chains of cytochrome c oxidase, the terminal oxidase in mitochondrial electron transport. Ubiquitous. Belongs to the cytochrome c oxidase IV family.

Protein type: Oxidoreductase; EC 1.9.3.1; Mitochondrial; Membrane protein, integral; Energy Metabolism - oxidative phosphorylation

Chromosomal Location of Human Ortholog: 16q24.1

Cellular Component: membrane; mitochondrial inner membrane; mitochondrial respiratory chain complex IV; mitochondrion; nucleus

Molecular Function: protein binding

Biological Process: generation of precursor metabolites and energy; mitochondrial electron transport, cytochrome c to oxygen

Research Articles on COX4I1

Similar Products

Product Notes

The COX4I1 cox4i1 (Catalog #AAA1275664) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgttggcta ccagggtatt tagcctagtt ggcaagcgag caatttccac ctctgtgtgt gtacgagctc atgaaagtgt tgtgaagagc gaagactttt cgctcccagc ttatatggat cggcgtgacc accccttgcc ggaggtggcc catgtcaagc acctgtctgc cagccagaag gcactgaagg agaaggagaa ggcctcctgg agcagcctct ccatggatga gaaagtcgag ttgtatcgca ttaagttcaa ggagagcttt gctgagatga acaggggctc gaacgagtgg aagacggttg tgggcggtgc catgttcttc atcggtttca ccgcgctcgt tatcatgtgg cagaagcact atgtgtacgg ccccctcccg caaagctttg acaaagagtg ggtggccaag cagaccaaga ggatgctgga catgaaggtg aaccccatcc agggcttagc ctccaagtgg gactacgaaa agaacgagtg gaagaagtga. It is sometimes possible for the material contained within the vial of "COX4I1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.