Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

NCK2 cdna clone

NCK2 cDNA Clone

Gene Names
NCK2; GRB4; NCKbeta
Synonyms
NCK2; NCK2 cDNA Clone; NCK2 cdna clone
Ordering
For Research Use Only!
Sequence
atgacagaagaagttattgtgatagccaagtgggactacaccgcccagcaggaccaggagctggacatcaagaagaacgagcggctgtggttgctggacgactccaagacgtggtggcgggtgaggaacgcggccaacaggacgggctatgtaccgtccaactacgtggagcggaagaacagcctgaagaagggctccctcgtgaagaacctgaaggacacactaggcctcggcaagacgcgcaggaagaccagcgcgcgggatgcgtcccccacgcccagcacggacgccgagtaccccgccaatggcagcggcgccgaccgcatctacgacctcaacatcccggccttcgtcaagttcgcctatgtggccgagcgggaggatgagttgtccctggtgaaggggtcgcgcgtcaccgtcatggagaagtgcagcgacggttggtggcggggcagctacaacgggcagatcggctggttcccctccaactacgtcttggaggaggtggacgaggcggctgcggagtccccaagcttcctgagcctgcgcaagggcgcctcgctgagcaatggccagggctcccgcgtgctgcatgtggtccagacgctgtaccccttcagctcagtcaccgaggaggagctcaacttcgagaagggggagaccatggaggtgattgagaagccggagaacgaccccgagtggtggaaatgcaaaaatgcccggggccaggtgggcctcgtccccaaaaactacgtggtggtcctcagtgacgggcctgccctgcaccctgcgcacgccccacagataagctacaccgggccctcgtccagcgggcgcttcgcgggcagagagtggtactacgggaacgtgacgcggcaccaggccgagtgcgccctcaacgagcggggcgtggagggcgacttcctcattagggacagcgagtcctcgcccagcgacttctccgtgtcccttaaagcgtcagggaagaacaaacacttcaaggtgcagctcgtggacaatgtctactgcattgggcagcggcgcttccacaccatggacgagctggtggaacactacaaaaaggcgcccatcttcaccagcgagcacggggagaagctctacctcgtcagggccctgcagtga
Sequence Length
1143
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
42,915 Da
NCBI Official Full Name
Homo sapiens NCK adaptor protein 2, mRNA
NCBI Official Synonym Full Names
NCK adaptor protein 2
NCBI Official Symbol
NCK2
NCBI Official Synonym Symbols
GRB4; NCKbeta
NCBI Protein Information
cytoplasmic protein NCK2
UniProt Protein Name
Cytoplasmic protein NCK2
Protein Family
UniProt Gene Name
NCK2
UniProt Synonym Gene Names
GRB4; Nck-2
UniProt Entry Name
NCK2_HUMAN

NCBI Description

This gene encodes a member of the NCK family of adaptor proteins. The protein contains three SH3 domains and one SH2 domain. The protein has no known catalytic function but has been shown to bind and recruit various proteins involved in the regulation of receptor protein tyrosine kinases. It is through these regulatory activities that this protein is believed to be involved in cytoskeletal reorganization. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008]

Uniprot Description

NCK2: Adapter protein which associates with tyrosine- phosphorylated growth factor receptors or their cellular substrates. Maintains low levels of EIF2S1 phosphorylation by promoting its dephosphorylation by PP1. Plays a role in ELK1- dependent transcriptional activation in response to activated Ras signaling.

Protein type: Adaptor/scaffold; Motility/polarity/chemotaxis

Chromosomal Location of Human Ortholog: 2q12

Cellular Component: cytoplasm; cytosol; endoplasmic reticulum; trans-Golgi network

Molecular Function: ARF guanyl-nucleotide exchange factor activity; protein binding

Biological Process: ephrin receptor signaling pathway; epidermal growth factor receptor signaling pathway; negative regulation of cell proliferation; negative regulation of peptidyl-serine phosphorylation; positive regulation of actin filament polymerization; positive regulation of T cell proliferation; positive regulation of transcription from RNA polymerase II promoter; regulation of epidermal growth factor receptor activity; signal transduction; vascular endothelial growth factor receptor signaling pathway; vesicle-mediated transport

Research Articles on NCK2

Similar Products

Product Notes

The NCK2 nck2 (Catalog #AAA1275622) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgacagaag aagttattgt gatagccaag tgggactaca ccgcccagca ggaccaggag ctggacatca agaagaacga gcggctgtgg ttgctggacg actccaagac gtggtggcgg gtgaggaacg cggccaacag gacgggctat gtaccgtcca actacgtgga gcggaagaac agcctgaaga agggctccct cgtgaagaac ctgaaggaca cactaggcct cggcaagacg cgcaggaaga ccagcgcgcg ggatgcgtcc cccacgccca gcacggacgc cgagtacccc gccaatggca gcggcgccga ccgcatctac gacctcaaca tcccggcctt cgtcaagttc gcctatgtgg ccgagcggga ggatgagttg tccctggtga aggggtcgcg cgtcaccgtc atggagaagt gcagcgacgg ttggtggcgg ggcagctaca acgggcagat cggctggttc ccctccaact acgtcttgga ggaggtggac gaggcggctg cggagtcccc aagcttcctg agcctgcgca agggcgcctc gctgagcaat ggccagggct cccgcgtgct gcatgtggtc cagacgctgt accccttcag ctcagtcacc gaggaggagc tcaacttcga gaagggggag accatggagg tgattgagaa gccggagaac gaccccgagt ggtggaaatg caaaaatgcc cggggccagg tgggcctcgt ccccaaaaac tacgtggtgg tcctcagtga cgggcctgcc ctgcaccctg cgcacgcccc acagataagc tacaccgggc cctcgtccag cgggcgcttc gcgggcagag agtggtacta cgggaacgtg acgcggcacc aggccgagtg cgccctcaac gagcggggcg tggagggcga cttcctcatt agggacagcg agtcctcgcc cagcgacttc tccgtgtccc ttaaagcgtc agggaagaac aaacacttca aggtgcagct cgtggacaat gtctactgca ttgggcagcg gcgcttccac accatggacg agctggtgga acactacaaa aaggcgccca tcttcaccag cgagcacggg gagaagctct acctcgtcag ggccctgcag tga. It is sometimes possible for the material contained within the vial of "NCK2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.