Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

EFNB1 cdna clone

EFNB1 cDNA Clone

Gene Names
EFNB1; CFND; CFNS; EFB1; EFL3; EPLG2; Elk-L; LERK2
Synonyms
EFNB1; EFNB1 cDNA Clone; EFNB1 cdna clone
Ordering
For Research Use Only!
Sequence
atggctcggcctgggcagcgttggctcggcaagtggcttgtggcgatggtcgtgtgggcgctgtgccggctcgccacaccgctggccaagaacctggagcccgtatcctggagctccctcaaccccaagttcctgagtgggaagggcttggtgatctatccgaaaattggagacaagctggacatcatctgcccccgagcagaagcagggcggccctatgagtactacaagctgtacctggtgcggcctgagcaggcagctgcctgtagcacagttctcgaccccaacgtgttggtcacctgcaataggccagagcaggaaatacgctttaccatcaagttccaggagttcagccccaactacatgggcctggagttcaagaagcaccatgattactacattacctcaacatccaatggaagcctggaggggctggaaaaccgggagggcggtgtgtgccgcacacgcaccatgaagatcatcatgaaggttgggcaagatcccaatgctgtgacgcctgagcagctgactaccagcaggcccagcaaggaggcagacaacactgtcaagatggccacacaggcccctggtagtcggggctccctgggtgactctgatggcaagcatgagactgtgaaccaggaagagaagagtggcccaggtgcaagtgggggcagcagcggggaccctgatggcttcttcaactccaaggtggcattgttcgcggctgtcggtgccggttgcgtcatcttcctgctcatcatcatcttcctgacggtcctactactgaagctacgcaagcggcaccgcaagcacacacagcagcgggcggctgccctctcgctcagtaccctggccagtcccaaggggggcagtggcacagcgggcaccgagcccagcgacatcatcattcccttacggactacagagaacaactactgcccccactatgagaaggtgagtggggactacgggcaccctgtctacatcgtccaagagatgccgccccagagcccggcgaacatctactacaaggtctga
Sequence Length
1041
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
38,007 Da
NCBI Official Full Name
Homo sapiens ephrin-B1, mRNA
NCBI Official Synonym Full Names
ephrin B1
NCBI Official Symbol
EFNB1
NCBI Official Synonym Symbols
CFND; CFNS; EFB1; EFL3; EPLG2; Elk-L; LERK2
NCBI Protein Information
ephrin-B1
UniProt Protein Name
Ephrin-B1
Protein Family
UniProt Gene Name
EFNB1
UniProt Synonym Gene Names
EFL3; EPLG2; LERK2; ELK-L; LERK-2
UniProt Entry Name
EFNB1_HUMAN

NCBI Description

The protein encoded by this gene is a type I membrane protein and a ligand of Eph-related receptor tyrosine kinases. It may play a role in cell adhesion and function in the development or maintenance of the nervous system. [provided by RefSeq, Jul 2008]

Uniprot Description

EFNB1: a type I membrane protein of the ephrin family. A ligand of Eph-related receptor tyrosine kinases EphB1 and EphA1. Ephrins and ephrin receptors mediate numerous developmental processes, particularly in the nervous system. Ephrin-B1 may play a role in cell adhesion and functions in the development or maintenance of the nervous system. Binding to its receptor induces the collapse of commissural axons/growth cones in vitro. Induced by TNF-alpha. Expressed in brain, heart, placenta, lung, liver, skeletal muscle, kidney, and pancreas.

Protein type: Ligand, receptor tyrosine kinase; Membrane protein, integral

Chromosomal Location of Human Ortholog: Xq12

Cellular Component: integral to plasma membrane; plasma membrane; synapse

Molecular Function: protein binding

Biological Process: axon guidance; cell adhesion; cell-cell signaling; ephrin receptor signaling pathway

Disease: Craniofrontonasal Syndrome

Research Articles on EFNB1

Similar Products

Product Notes

The EFNB1 efnb1 (Catalog #AAA1275605) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggctcggc ctgggcagcg ttggctcggc aagtggcttg tggcgatggt cgtgtgggcg ctgtgccggc tcgccacacc gctggccaag aacctggagc ccgtatcctg gagctccctc aaccccaagt tcctgagtgg gaagggcttg gtgatctatc cgaaaattgg agacaagctg gacatcatct gcccccgagc agaagcaggg cggccctatg agtactacaa gctgtacctg gtgcggcctg agcaggcagc tgcctgtagc acagttctcg accccaacgt gttggtcacc tgcaataggc cagagcagga aatacgcttt accatcaagt tccaggagtt cagccccaac tacatgggcc tggagttcaa gaagcaccat gattactaca ttacctcaac atccaatgga agcctggagg ggctggaaaa ccgggagggc ggtgtgtgcc gcacacgcac catgaagatc atcatgaagg ttgggcaaga tcccaatgct gtgacgcctg agcagctgac taccagcagg cccagcaagg aggcagacaa cactgtcaag atggccacac aggcccctgg tagtcggggc tccctgggtg actctgatgg caagcatgag actgtgaacc aggaagagaa gagtggccca ggtgcaagtg ggggcagcag cggggaccct gatggcttct tcaactccaa ggtggcattg ttcgcggctg tcggtgccgg ttgcgtcatc ttcctgctca tcatcatctt cctgacggtc ctactactga agctacgcaa gcggcaccgc aagcacacac agcagcgggc ggctgccctc tcgctcagta ccctggccag tcccaagggg ggcagtggca cagcgggcac cgagcccagc gacatcatca ttcccttacg gactacagag aacaactact gcccccacta tgagaaggtg agtggggact acgggcaccc tgtctacatc gtccaagaga tgccgcccca gagcccggcg aacatctact acaaggtctg a. It is sometimes possible for the material contained within the vial of "EFNB1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.