Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

EED cdna clone

EED cDNA Clone

Gene Names
EED; HEED; WAIT1
Synonyms
EED; EED cDNA Clone; EED cdna clone
Ordering
For Research Use Only!
Sequence
atgtccgagagggaagtgtcgactgcgccggcgggaacagacatgcctgcggccaagaagcagaagctgagcagtgacgagaacagcaatccagacctctctggagacgagaatgatgacgctgtcagtatagaaagtggtacaaacactgaacgccctgatacacctacaaacacgccaaatgcacctggaaggaaaagttggggaaagggaaaatggaagtcaaagaaatgcaaatattctttcaaatgtgtaaatagtctcaaggaagatcataaccaaccattgtttggagttcagtttaactggcacagtaaagaaggagatccattagtgtttgcaactgtaggaagcaacagagttaccttgtatgaatgtcattcacaaggagaaatccggttgttgcaatcttacgtggatgctgatgctgatgaaaacttttacacttgtgcatggacctatgatagcaatacgagccatcctctgctggctgtagctggatctagaggcataattaggataataaatcctataacaatgcagtgtataaagcactatgttggccatggaaatgctatcaatgagctgaaattccatccaagagatccaaatcttctcctgtcagtaagtaaagatcatgctttacgattatggaatatccagacggacactctggtggcaatatttggaggcgtagaagggcacagagatgaagttctaagtgctgattatgatcttttgggtgaaaaaataatgtcctgtggtatggatcattctcttaaactttggaggatcaattcaaagagaatgatgaatgcaattaaggaatcttatgattataatccaaataaaactaacaggccatttatttctcagaaaatccattttcctgatttttctaccagagacatacataggaattatgttgattgtgtgcgatggttaggcgatttgatactttctaagagtggccgtgccattttacattcccaccagcaatgtatgagagatccagtgtctccgaatcttcgccagcatttgtcttgtgaaaatgccattgtgtgctggaaacctggcaagatggaagatgatatagataaaattaaacccagtgaatctaatgtgactattcttgggcgatttgattacagccagtgtgacatttggtacatgaggttttctatggatttctggcaaaagatgcttgcattgggcaatcaagttggcaaactttatgtttgggatttagaagtagaagatcctcataaagccaaatgtacaacactgactcatcataaatgtggtgctgctattcgacaaaccagttttagcagggatagcagcattcttatagctgtttgtgatgatgccagtatttggcgctgggatcgacttcgataa
Sequence Length
1401
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
45,524 Da
NCBI Official Full Name
Homo sapiens embryonic ectoderm development, mRNA
NCBI Official Synonym Full Names
embryonic ectoderm development
NCBI Official Symbol
EED
NCBI Official Synonym Symbols
HEED; WAIT1
NCBI Protein Information
polycomb protein EED
UniProt Protein Name
Polycomb protein EED
Protein Family
UniProt Gene Name
EED
UniProt Synonym Gene Names
hEED; WAIT-1
UniProt Entry Name
EED_HUMAN

NCBI Description

This gene encodes a member of the Polycomb-group (PcG) family. PcG family members form multimeric protein complexes, which are involved in maintaining the transcriptional repressive state of genes over successive cell generations. This protein interacts with enhancer of zeste 2, the cytoplasmic tail of integrin beta7, immunodeficiency virus type 1 (HIV-1) MA protein, and histone deacetylase proteins. This protein mediates repression of gene activity through histone deacetylation, and may act as a specific regulator of integrin function. Two transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]

Uniprot Description

EED: a member of the superfamily of Polycomb group (PcG) methyltransferase proteins with WD-40 repeats. PcG complexes mediate chromatin modifications that contribute to transcriptional silencing during development and carcinogenesis. A part of the Polycomb-repressive complex 2 (PRC2) along with EZH2, SUZ12, RBBP4 and RBBP7 and possibly AEBP2. Interacts with HDAC, HDAC2, histone H1 and YY1. PRC2 trimethylates histone H3 on K9 and K27, transcriptionally repressing target gene including HOXC8, HOXA9, MYT1 and CDKN2A. Appears to be overexpressed in breast and colon cancers. Inhibitors of PRC2-mediated gene repression are being investigated as a cancer therapy. EED and EZH2 are also implicated in the silencing of the inactive X chromosome. Three human isoforms produced by alternative splicing or initiation have been described, and additional isoforms may be produced by alternative initiation.

Protein type: Methyltransferase

Chromosomal Location of Human Ortholog: 11q14.2-q22.3

Cellular Component: ESC/E(Z) complex; nucleolus; nucleoplasm; nucleus

Molecular Function: histone methyltransferase activity; identical protein binding; protein binding

Biological Process: negative regulation of gene expression, epigenetic

Research Articles on EED

Similar Products

Product Notes

The EED eed (Catalog #AAA1275591) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtccgaga gggaagtgtc gactgcgccg gcgggaacag acatgcctgc ggccaagaag cagaagctga gcagtgacga gaacagcaat ccagacctct ctggagacga gaatgatgac gctgtcagta tagaaagtgg tacaaacact gaacgccctg atacacctac aaacacgcca aatgcacctg gaaggaaaag ttggggaaag ggaaaatgga agtcaaagaa atgcaaatat tctttcaaat gtgtaaatag tctcaaggaa gatcataacc aaccattgtt tggagttcag tttaactggc acagtaaaga aggagatcca ttagtgtttg caactgtagg aagcaacaga gttaccttgt atgaatgtca ttcacaagga gaaatccggt tgttgcaatc ttacgtggat gctgatgctg atgaaaactt ttacacttgt gcatggacct atgatagcaa tacgagccat cctctgctgg ctgtagctgg atctagaggc ataattagga taataaatcc tataacaatg cagtgtataa agcactatgt tggccatgga aatgctatca atgagctgaa attccatcca agagatccaa atcttctcct gtcagtaagt aaagatcatg ctttacgatt atggaatatc cagacggaca ctctggtggc aatatttgga ggcgtagaag ggcacagaga tgaagttcta agtgctgatt atgatctttt gggtgaaaaa ataatgtcct gtggtatgga tcattctctt aaactttgga ggatcaattc aaagagaatg atgaatgcaa ttaaggaatc ttatgattat aatccaaata aaactaacag gccatttatt tctcagaaaa tccattttcc tgatttttct accagagaca tacataggaa ttatgttgat tgtgtgcgat ggttaggcga tttgatactt tctaagagtg gccgtgccat tttacattcc caccagcaat gtatgagaga tccagtgtct ccgaatcttc gccagcattt gtcttgtgaa aatgccattg tgtgctggaa acctggcaag atggaagatg atatagataa aattaaaccc agtgaatcta atgtgactat tcttgggcga tttgattaca gccagtgtga catttggtac atgaggtttt ctatggattt ctggcaaaag atgcttgcat tgggcaatca agttggcaaa ctttatgttt gggatttaga agtagaagat cctcataaag ccaaatgtac aacactgact catcataaat gtggtgctgc tattcgacaa accagtttta gcagggatag cagcattctt atagctgttt gtgatgatgc cagtatttgg cgctgggatc gacttcgata a. It is sometimes possible for the material contained within the vial of "EED, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.