Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

XRCC6BP1 cdna clone

XRCC6BP1 cDNA Clone

Gene Names
ATP23; KUB3; XRCC6BP1
Synonyms
XRCC6BP1; XRCC6BP1 cDNA Clone; XRCC6BP1 cdna clone
Ordering
For Research Use Only!
Sequence
atggcgggagctccggacgagcgccggcggggccccgcggcaggggagcagctgcagcagcaacacgtctcttgccaggtcttccccgagcgtctggcccaggggaatccccagcaagggttcttctccagcttcttcaccagcaaccagaagtgccagcttaggctcctgaagacgctggagacaaatccatatgtcaaacttctgcttgatgctatgaaacactcaggttgtgctgttaacaaagatagacacttttcttgcgaagactgtaatggaaatgtcagtggaggttttgatgcttcaacatctcagatagttttgtgccagaataatatccataatcaggcccatatgaacagagtggtcacacacgagcttattcatgcatttgatcattgtcgtgcccatgtcgactggttcaccaacatcagacatttggcgtgctcagaggttcgagctgctaaccttagtggagactgctcacttgtcaatgaaatattcaggttacattttggattaaaacaacaccaccagacttgtgtgcgagacagagccactctttctatcctggctgttaggaatatcagcaaagaagtagctaaaaaggctgttgatgaagtttttgaatcttgtttcaatgaccatgaaccttttggaaggatcccacataacaagacttatgcaagatatgctcacagagactttgaaaaccgtgatcggtattattcaaatatatga
Sequence Length
741
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
28,081 Da
NCBI Official Full Name
Homo sapiens XRCC6 binding protein 1, mRNA
NCBI Official Synonym Full Names
ATP23 metallopeptidase and ATP synthase assembly factor homolog
NCBI Official Symbol
ATP23
NCBI Official Synonym Symbols
KUB3; XRCC6BP1
NCBI Protein Information
mitochondrial inner membrane protease ATP23 homolog
UniProt Protein Name
Mitochondrial inner membrane protease ATP23 homolog
UniProt Gene Name
ATP23
UniProt Entry Name
ATP23_HUMAN

NCBI Description

The protein encoded by this gene is amplified in glioblastomas and interacts with the DNA binding subunit of DNA-dependent protein kinase. This kinase is involved in double-strand break repair (DSB), and higher expression of the encoded protein increases the efficiency of DSB. In addition, comparison to orthologous proteins strongly suggests that this protein is a metalloprotease important in the biosynthesis of mitochondrial ATPase. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2016]

Uniprot Description

XRCC6BP1: Belongs to the peptidase M76 family.

Protein type: DNA repair, damage; Protease; EC 3.4.24.-

Chromosomal Location of Human Ortholog: 12q14.1

Cellular Component: intracellular membrane-bound organelle; plasma membrane

Molecular Function: DNA-dependent protein kinase activity

Biological Process: double-strand break repair via nonhomologous end joining

Research Articles on XRCC6BP1

Similar Products

Product Notes

The XRCC6BP1 atp23 (Catalog #AAA1275584) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcgggag ctccggacga gcgccggcgg ggccccgcgg caggggagca gctgcagcag caacacgtct cttgccaggt cttccccgag cgtctggccc aggggaatcc ccagcaaggg ttcttctcca gcttcttcac cagcaaccag aagtgccagc ttaggctcct gaagacgctg gagacaaatc catatgtcaa acttctgctt gatgctatga aacactcagg ttgtgctgtt aacaaagata gacacttttc ttgcgaagac tgtaatggaa atgtcagtgg aggttttgat gcttcaacat ctcagatagt tttgtgccag aataatatcc ataatcaggc ccatatgaac agagtggtca cacacgagct tattcatgca tttgatcatt gtcgtgccca tgtcgactgg ttcaccaaca tcagacattt ggcgtgctca gaggttcgag ctgctaacct tagtggagac tgctcacttg tcaatgaaat attcaggtta cattttggat taaaacaaca ccaccagact tgtgtgcgag acagagccac tctttctatc ctggctgtta ggaatatcag caaagaagta gctaaaaagg ctgttgatga agtttttgaa tcttgtttca atgaccatga accttttgga aggatcccac ataacaagac ttatgcaaga tatgctcaca gagactttga aaaccgtgat cggtattatt caaatatatg a. It is sometimes possible for the material contained within the vial of "XRCC6BP1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.