Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PLCD1 cdna clone

PLCD1 cDNA Clone

Gene Names
PLCD1; NDNC3; PLC-III
Synonyms
PLCD1; PLCD1 cDNA Clone; PLCD1 cdna clone
Ordering
For Research Use Only!
Sequence
atggactcgggccgggacttcctgaccctgcacggcctacaggatgatgaggatctacaggcgctgctgaagggcagccagctcctgaaggtgaagtccagctcatggaggagagagcgcttctacaagttgcaggaggactgcaagaccatctggcaggagtcccgcaaggtcatgcggaccccggagtcccagctgttctccatcgaggacattcaggaggtgcgaatggggcaccgcacggagggtctggagaagttcgcccgtgatgtgcccgaggaccgctgcttctccattgtcttcaaggaccagcgcaatacactagacctcatcgccccatcgccagctgatgcccagcactgggtgctggggctgcacaagatcatccaccactcaggctccatggaccagcgtcagaagctacagcactggattcactcctgcttgcgaaaagctgacaaaaacaaggacaacaagatgagcttcaaggagctgcagaacttcctgaaggagctcaacatccaggtggacgacagctatgcccggaagatcttcagggagtgtgaccactcccagacagactccctggaggacgaggagattgaggccttctacaagatgctgacccagcgggtggagatcgaccgcaccttcgccgaggccgcgggctcaggggagactctgtcggtggatcagttagtgacgttcctgcagcaccagcagcgggaggaggcggcagggcctgcgctggccctctccctcattgagcgctacgagcccagcgagactgccaaggcgcagcggcagatgaccaaggacggcttcctcatgtacttactgtcggctgacggcagcgccttcagcctggcacaccgccgtgtctaccaggacatgggccagccacttagccactacctggtgtcctcttcacacaacacctacctgctggaggaccagctagccgggcccagcagcactgaagcctacatccgggcactgtgcaaaggctgccgatgcctggagcttgactgctgggacgggcccaaccaggaaccaatcatctaccacggctatactttcacttccaagatcctcttctgcgatgtgctcagggccatccgggactatgccttcaaggcgtccccctaccctgtcatcctatccctggagaaccactgcacactggagcagcagcgcgtgatggcgcggcacctgcatgccatcctgggccccatgctgttgaaccgaccactggatggggtcaccaacagcctgccctcccctgagcaactgaaggggaagatcctgctgaaggggaagaagctcggggggctcctgccccctggaggggagggtggccctgaggccactgtggtgtcagacgaagacgaggctgctgagatggaggatgaggcagtgaggagccgtgtgcagcacaagcccaaggaggacaagctcaggctagcacaggagctctctgacatggtcatttactgcaagagtgtccactttgggggcttctccagtcctggcacccctggacaggccttctacgagatggcgtccttctctgagaaccgtgcccttcgactgctccaagaatcaggaaacggctttgtccgccacaacgtggggcacctgagcagaatctacccggctggatggagaacagactcctccaactacagccccgtggagatgtggaatgggggctgccagatcgtggccctgaatttccagacacctgggccagagatggacgtgtaccagggccgcttccaggacaacggggcctgtgggtacgtgctgaagcccgccttcctgcgagaccccaacggcacctttaacccccgcgccctggctcaggggccctggtgggcacggaagcggctcaacatcagggtcatttcggggcagcagctgccaaaagtcaacaagaataagaattcaattgtggaccccaaagtgacagtggagatccatggcgtgagccgggacgtggccagccgccagactgctgtcatcaccaacaatggtttcaacccatggtgggacacggagtttgcgtttgaggtagttgtgcctgaccttgccctcatccgcttcttggtggaagattatgatgcctcctccaagaatgacttcattggccagagtaccatccccttgaacagcctcaagcaaggataccgccatgtccacctcatgtctaagaacggggaccagcatccatcagccaccctctttgtgaagatctccctccaggactag
Sequence Length
2271
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
88,135 Da
NCBI Official Full Name
Homo sapiens phospholipase C, delta 1, mRNA
NCBI Official Synonym Full Names
phospholipase C delta 1
NCBI Official Symbol
PLCD1
NCBI Official Synonym Symbols
NDNC3; PLC-III
NCBI Protein Information
1-phosphatidylinositol 4,5-bisphosphate phosphodiesterase delta-1
UniProt Protein Name
1-phosphatidylinositol 4,5-bisphosphate phosphodiesterase delta-1
UniProt Gene Name
PLCD1
UniProt Synonym Gene Names
PLC-III; PLC-delta-1
UniProt Entry Name
PLCD1_HUMAN

NCBI Description

This gene encodes a member of the phospholipase C family. Phospholipase C isozymes play critical roles in intracellular signal transduction by catalyzing the hydrolysis of phosphatidylinositol 4,5-bisphosphate (PIP2) into the second messengers diacylglycerol (DAG) and inositol triphosphate (IP3). The encoded protein functions as a tumor suppressor in several types of cancer, and mutations in this gene are a cause of hereditary leukonychia. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Dec 2011]

Uniprot Description

PLCD1: The production of the second messenger molecules diacylglycerol (DAG) and inositol 1,4,5-trisphosphate (IP3) is mediated by activated phosphatidylinositol-specific phospholipase C enzymes. Essential for trophoblast and placental development. Defects in PLCD1 are the cause of nail disorder non- syndromic congenital type 3 (NDNC3). NDNC3 is a nail disorder characterized by a white appearance of the nail plate (true leukonychia), the nail bed (pseudoleukonychia), or neither (apparent leukonychia). Leukonychia may involve all of the nail (leukonychia totalis) or only part of the nail (leukonychia partialis), or can appear as one or more transverse bands (leukonychia striata) or white spots (leukonychia punctata). 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Carbohydrate Metabolism - inositol phosphate; EC 3.1.4.11; Phospholipase

Chromosomal Location of Human Ortholog: 3p22-p21.3

Cellular Component: cytoplasm; plasma membrane

Molecular Function: GTPase activating protein binding; phosphoinositide phospholipase C activity

Biological Process: inositol phosphate metabolic process; phospholipid metabolic process

Disease: Nail Disorder, Nonsyndromic Congenital, 3

Research Articles on PLCD1

Similar Products

Product Notes

The PLCD1 plcd1 (Catalog #AAA1275538) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggactcgg gccgggactt cctgaccctg cacggcctac aggatgatga ggatctacag gcgctgctga agggcagcca gctcctgaag gtgaagtcca gctcatggag gagagagcgc ttctacaagt tgcaggagga ctgcaagacc atctggcagg agtcccgcaa ggtcatgcgg accccggagt cccagctgtt ctccatcgag gacattcagg aggtgcgaat ggggcaccgc acggagggtc tggagaagtt cgcccgtgat gtgcccgagg accgctgctt ctccattgtc ttcaaggacc agcgcaatac actagacctc atcgccccat cgccagctga tgcccagcac tgggtgctgg ggctgcacaa gatcatccac cactcaggct ccatggacca gcgtcagaag ctacagcact ggattcactc ctgcttgcga aaagctgaca aaaacaagga caacaagatg agcttcaagg agctgcagaa cttcctgaag gagctcaaca tccaggtgga cgacagctat gcccggaaga tcttcaggga gtgtgaccac tcccagacag actccctgga ggacgaggag attgaggcct tctacaagat gctgacccag cgggtggaga tcgaccgcac cttcgccgag gccgcgggct caggggagac tctgtcggtg gatcagttag tgacgttcct gcagcaccag cagcgggagg aggcggcagg gcctgcgctg gccctctccc tcattgagcg ctacgagccc agcgagactg ccaaggcgca gcggcagatg accaaggacg gcttcctcat gtacttactg tcggctgacg gcagcgcctt cagcctggca caccgccgtg tctaccagga catgggccag ccacttagcc actacctggt gtcctcttca cacaacacct acctgctgga ggaccagcta gccgggccca gcagcactga agcctacatc cgggcactgt gcaaaggctg ccgatgcctg gagcttgact gctgggacgg gcccaaccag gaaccaatca tctaccacgg ctatactttc acttccaaga tcctcttctg cgatgtgctc agggccatcc gggactatgc cttcaaggcg tccccctacc ctgtcatcct atccctggag aaccactgca cactggagca gcagcgcgtg atggcgcggc acctgcatgc catcctgggc cccatgctgt tgaaccgacc actggatggg gtcaccaaca gcctgccctc ccctgagcaa ctgaagggga agatcctgct gaaggggaag aagctcgggg ggctcctgcc ccctggaggg gagggtggcc ctgaggccac tgtggtgtca gacgaagacg aggctgctga gatggaggat gaggcagtga ggagccgtgt gcagcacaag cccaaggagg acaagctcag gctagcacag gagctctctg acatggtcat ttactgcaag agtgtccact ttgggggctt ctccagtcct ggcacccctg gacaggcctt ctacgagatg gcgtccttct ctgagaaccg tgcccttcga ctgctccaag aatcaggaaa cggctttgtc cgccacaacg tggggcacct gagcagaatc tacccggctg gatggagaac agactcctcc aactacagcc ccgtggagat gtggaatggg ggctgccaga tcgtggccct gaatttccag acacctgggc cagagatgga cgtgtaccag ggccgcttcc aggacaacgg ggcctgtggg tacgtgctga agcccgcctt cctgcgagac cccaacggca cctttaaccc ccgcgccctg gctcaggggc cctggtgggc acggaagcgg ctcaacatca gggtcatttc ggggcagcag ctgccaaaag tcaacaagaa taagaattca attgtggacc ccaaagtgac agtggagatc catggcgtga gccgggacgt ggccagccgc cagactgctg tcatcaccaa caatggtttc aacccatggt gggacacgga gtttgcgttt gaggtagttg tgcctgacct tgccctcatc cgcttcttgg tggaagatta tgatgcctcc tccaagaatg acttcattgg ccagagtacc atccccttga acagcctcaa gcaaggatac cgccatgtcc acctcatgtc taagaacggg gaccagcatc catcagccac cctctttgtg aagatctccc tccaggacta g. It is sometimes possible for the material contained within the vial of "PLCD1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.