Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

GRK6 cdna clone

GRK6 cDNA Clone

Gene Names
GRK6; GPRK6
Synonyms
GRK6; GRK6 cDNA Clone; GRK6 cdna clone
Ordering
For Research Use Only!
Sequence
atggagctcgagaacatcgtagcgaacacggtgctactcaaggcccgggaaggtggcggtggaaatcgcaaaggcaaaagcaagaaatggcggcagatgctccagttccctcacatcagccagtgcgaagagctgcggctcagcctcgagcgtgactatcacagcctgtgcgagcggcagcccattgggcgcctgctgttccgagagttctgtgccacgaggccggagctgagccgctgcgtcgccttcctggatggggtggccgagtatgaagtgaccccggatgacaagcggaaggcatgtgggcggcagctaacgcagaattttctgagccacacgggtcctgacctcatccctgaggtcccccggcagctggtgacgaactgcacccagcggctggagcagggtccctgcaaagaccttttccaggaactcacccggctgacccacgagtacctgagcgtggccccttttgccgactacctcgacagcatctacttcaaccgtttcctgcagtggaagtggctggaaaggcagccagtgaccaaaaacaccttcaggcaataccgagtcctgggcaaaggtggctttggggaggtgtgcgcctgccaggtgcgggccacaggtaagatgtatgcctgcaagaagctagagaaaaagcggatcaagaagcggaaaggggaggccatggcgctgaacgagaagcagatcctggagaaagtgaacagtaggtttgtagtgagcttggcctacgcctatgagaccaaggacgcgctgtgcctggtgctgacactgatgaacgggggcgacctcaagttccacatctaccacatgggccaggctggcttccccgaagcgcgggccgtcttctacgccgccgagatctgctgtggcctggaggacctgcaccgggagcgcatcgtgtacagggacctgaagcccgagaacatcttgctggatgaccacggccacatccgcatctctgacctgggactagctgtgcatgtgcccgagggccagaccatcaaagggcgtgtgggcaccgtgggttacatggctccggaggtggtgaagaatgaacggtacacgttcagccctgactggtgggcgctcggctgcttcctgtacgagatgatcgcaggccagtcgcccttccagcagaggaagaagaagatcaagcgggaggaggtggagcggctggtgaaggaggtccccgaggagtattccgagcgcttttccccgcaggcccgctcactttgctcacagctcctctgcaaggaccctgccgaacgcctggggtgtcgtgggggcagtgcccgcgaggtgaaggagcaccccctctttaagaagctgaacttcaagcggctgggagctggcatgctggagccgcccttcaagcctgacccccaggccatttactgcaaggatgttctggacattgaacagttctctacggtcaagggcgtggagctggagcctaccgaccaggacttctaccagaagtttgccacaggcagtgtgcccatcccctggcagaacgagatggtggagaccgagtgcttccaggagctgaatgtctttgggctggatggctcagttcccccagacctggactggaagggccagccacctgcacctcctaaaaagggactgctgcagagactcttcagtcgccaaaggattgctgtggaaactgcagcgacagcgaggaagagctccccacccgcctctagcccccagcccgaggcccccaccagcagttggcggtag
Sequence Length
1770
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
64,294 Da
NCBI Official Full Name
Homo sapiens G protein-coupled receptor kinase 6, mRNA
NCBI Official Synonym Full Names
G protein-coupled receptor kinase 6
NCBI Official Symbol
GRK6
NCBI Official Synonym Symbols
GPRK6
NCBI Protein Information
G protein-coupled receptor kinase 6
UniProt Protein Name
G protein-coupled receptor kinase 6
UniProt Gene Name
GRK6
UniProt Synonym Gene Names
GPRK6
UniProt Entry Name
GRK6_HUMAN

NCBI Description

This gene encodes a member of the guanine nucleotide-binding protein (G protein)-coupled receptor kinase subfamily of the Ser/Thr protein kinase family. The protein phosphorylates the activated forms of G protein-coupled receptors thus initiating their deactivation. Several transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2008]

Uniprot Description

GRK6: Specifically phosphorylates the activated forms of G protein-coupled receptors. Such receptor phosphorylation initiates beta-arrestin-mediated receptor desensitization, internalization, and signaling events leading to their desensitization. Seems to be involved in the desensitization of D2-like dopamin receptors in striatum and chemokine receptor CXCR4 which is critical for CXCL12-induced cell chemotaxis. Phosphorylates rhodopsin (RHO) (in vitro) and a non G-protein-coupled receptor: LRP6 during Wnt signaling (in vitro). Widely expressed. Belongs to the protein kinase superfamily. AGC Ser/Thr protein kinase family. GPRK subfamily. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: Kinase, protein; Protein kinase, Ser/Thr (non-receptor); Protein kinase, AGC; EC 2.7.11.16; AGC group; GRK family; GRK subfamily

Chromosomal Location of Human Ortholog: 5q35

Cellular Component: membrane; plasma membrane

Molecular Function: beta-adrenergic receptor kinase activity; protein binding

Biological Process: regulation of G-protein coupled receptor protein signaling pathway

Research Articles on GRK6

Similar Products

Product Notes

The GRK6 grk6 (Catalog #AAA1275531) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggagctcg agaacatcgt agcgaacacg gtgctactca aggcccggga aggtggcggt ggaaatcgca aaggcaaaag caagaaatgg cggcagatgc tccagttccc tcacatcagc cagtgcgaag agctgcggct cagcctcgag cgtgactatc acagcctgtg cgagcggcag cccattgggc gcctgctgtt ccgagagttc tgtgccacga ggccggagct gagccgctgc gtcgccttcc tggatggggt ggccgagtat gaagtgaccc cggatgacaa gcggaaggca tgtgggcggc agctaacgca gaattttctg agccacacgg gtcctgacct catccctgag gtcccccggc agctggtgac gaactgcacc cagcggctgg agcagggtcc ctgcaaagac cttttccagg aactcacccg gctgacccac gagtacctga gcgtggcccc ttttgccgac tacctcgaca gcatctactt caaccgtttc ctgcagtgga agtggctgga aaggcagcca gtgaccaaaa acaccttcag gcaataccga gtcctgggca aaggtggctt tggggaggtg tgcgcctgcc aggtgcgggc cacaggtaag atgtatgcct gcaagaagct agagaaaaag cggatcaaga agcggaaagg ggaggccatg gcgctgaacg agaagcagat cctggagaaa gtgaacagta ggtttgtagt gagcttggcc tacgcctatg agaccaagga cgcgctgtgc ctggtgctga cactgatgaa cgggggcgac ctcaagttcc acatctacca catgggccag gctggcttcc ccgaagcgcg ggccgtcttc tacgccgccg agatctgctg tggcctggag gacctgcacc gggagcgcat cgtgtacagg gacctgaagc ccgagaacat cttgctggat gaccacggcc acatccgcat ctctgacctg ggactagctg tgcatgtgcc cgagggccag accatcaaag ggcgtgtggg caccgtgggt tacatggctc cggaggtggt gaagaatgaa cggtacacgt tcagccctga ctggtgggcg ctcggctgct tcctgtacga gatgatcgca ggccagtcgc ccttccagca gaggaagaag aagatcaagc gggaggaggt ggagcggctg gtgaaggagg tccccgagga gtattccgag cgcttttccc cgcaggcccg ctcactttgc tcacagctcc tctgcaagga ccctgccgaa cgcctggggt gtcgtggggg cagtgcccgc gaggtgaagg agcaccccct ctttaagaag ctgaacttca agcggctggg agctggcatg ctggagccgc ccttcaagcc tgacccccag gccatttact gcaaggatgt tctggacatt gaacagttct ctacggtcaa gggcgtggag ctggagccta ccgaccagga cttctaccag aagtttgcca caggcagtgt gcccatcccc tggcagaacg agatggtgga gaccgagtgc ttccaggagc tgaatgtctt tgggctggat ggctcagttc ccccagacct ggactggaag ggccagccac ctgcacctcc taaaaaggga ctgctgcaga gactcttcag tcgccaaagg attgctgtgg aaactgcagc gacagcgagg aagagctccc cacccgcctc tagcccccag cccgaggccc ccaccagcag ttggcggtag. It is sometimes possible for the material contained within the vial of "GRK6, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.