Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

STARD10 cdna clone

STARD10 cDNA Clone

Gene Names
STARD10; PCTP2; CGI-52; NY-CO-28; SDCCAG28
Synonyms
STARD10; STARD10 cDNA Clone; STARD10 cdna clone
Ordering
For Research Use Only!
Sequence
atggagaagctggcggcctctacagagccccaagggcctcggccggtcctgggccgtgagagtgtccaggtgcccgatgaccaagactttcgcagcttccggtcagagtgtgaggctgaggtgggctggaacctgacctatagcagggctggggtgtctgtctgggtgcaggctgtggagatggatcggacgctgcacaagatcaagtgccggatggagtgctgtgatgtgccagccgagacactctacgacgtcctacacgacattgagtaccgcaagaaatgggacagcaacgtcattgagacttttgacatcgcccgcttgacagtcaacgctgacgtgggctattactcctggaggtgtcccaagcccctgaagaaccgtgatgtcatcaccctccgctcctggctccccatgggcgctgattacatcattatgaactactcagtcaaacatcccaaatacccacctcggaaagacttggtccgagctgtgtccatccagacgggctacctcatccagagcacagggcccaagagctgcgtcatcacctacctggcccaggtggaccccaaaggctccttacccaagtgggtggtgaataaatcttctcagttcctggctcccaaggccatgaagaagatgtacaaggcgtgcctcaagtaccccgagtggaaacagaagcacctgcctcacttcaagccgtggctgcacccggagcagagcccgttgccgagcctggcgctgtcggagctgtcggtgcagcatgcggactcactggagaacatcgacgagagcgcggtggccgagagcagagaggagcggatgggcggcgcgggcggcgagggcagcgacgacgacacctcgctcacctga
Sequence Length
876
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
33,049 Da
NCBI Official Full Name
Homo sapiens StAR-related lipid transfer (START) domain containing 10, mRNA
NCBI Official Synonym Full Names
StAR related lipid transfer domain containing 10
NCBI Official Symbol
STARD10
NCBI Official Synonym Symbols
PCTP2; CGI-52; NY-CO-28; SDCCAG28
NCBI Protein Information
PCTP-like protein
UniProt Protein Name
PCTP-like protein
Protein Family
UniProt Gene Name
STARD10
UniProt Synonym Gene Names
SDCCAG28; PCTP-L; StARD10
UniProt Entry Name
PCTL_HUMAN

Uniprot Description

STARD10: May play metabolic roles in sperm maturation or fertilization. Phospholipid transfer protein that preferentially selects lipid species containing a palmitoyl or stearoyl chain on the sn-1 and an unsaturated fatty acyl chain (18:1 or 18:2) on the sn-2 position. Able to transfer phosphatidylcholine (PC) and phosphatidyetanolamline (PE) between membranes.

Chromosomal Location of Human Ortholog: 11q13

Molecular Function: protein binding

Research Articles on STARD10

Similar Products

Product Notes

The STARD10 stard10 (Catalog #AAA1275429) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggagaagc tggcggcctc tacagagccc caagggcctc ggccggtcct gggccgtgag agtgtccagg tgcccgatga ccaagacttt cgcagcttcc ggtcagagtg tgaggctgag gtgggctgga acctgaccta tagcagggct ggggtgtctg tctgggtgca ggctgtggag atggatcgga cgctgcacaa gatcaagtgc cggatggagt gctgtgatgt gccagccgag acactctacg acgtcctaca cgacattgag taccgcaaga aatgggacag caacgtcatt gagacttttg acatcgcccg cttgacagtc aacgctgacg tgggctatta ctcctggagg tgtcccaagc ccctgaagaa ccgtgatgtc atcaccctcc gctcctggct ccccatgggc gctgattaca tcattatgaa ctactcagtc aaacatccca aatacccacc tcggaaagac ttggtccgag ctgtgtccat ccagacgggc tacctcatcc agagcacagg gcccaagagc tgcgtcatca cctacctggc ccaggtggac cccaaaggct ccttacccaa gtgggtggtg aataaatctt ctcagttcct ggctcccaag gccatgaaga agatgtacaa ggcgtgcctc aagtaccccg agtggaaaca gaagcacctg cctcacttca agccgtggct gcacccggag cagagcccgt tgccgagcct ggcgctgtcg gagctgtcgg tgcagcatgc ggactcactg gagaacatcg acgagagcgc ggtggccgag agcagagagg agcggatggg cggcgcgggc ggcgagggca gcgacgacga cacctcgctc acctga. It is sometimes possible for the material contained within the vial of "STARD10, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.