Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

UBE2E2 cdna clone

UBE2E2 cDNA Clone

Gene Names
UBE2E2; UBCH8
Synonyms
UBE2E2; UBE2E2 cDNA Clone; UBE2E2 cdna clone
Ordering
For Research Use Only!
Sequence
atgtccactgaggcacaaagagttgatgacagtccaagcactagtggaggaagttccgatggagatcaacgtgaaagtgttcagcaagaaccagaaagagaacaagttcagcccaagaaaaaggagggaaaaatatccagcaaaaccgctgctaaattgtcaactagtgctaaaagaattcagaaggaacttgcagaaatcacattggaccctcctcccaactgtagtgctggacccaaaggagacaacatttatgaatggaggtcaactatattgggacccccaggatctgtctatgaaggaggggtgttctttcttgacattaccttttcaccagactatccgtttaaaccccctaaggttaccttccgaacaagaatctatcactgtaatattaacagccaaggtgtgatctgtctggacatcttaaaggacaactggagtccggctttaactatttctaaagttctcctctccatctgctcacttcttacagattgcaaccctgctgaccctctggtgggcagcatcgccacacagtacatgaccaacagagcagagcatgaccggatggccagacagtggaccaagcggtacgccacatag
Sequence Length
606
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
22,255 Da
NCBI Official Full Name
Homo sapiens ubiquitin-conjugating enzyme E2E 2 (UBC4/5 homolog, yeast), mRNA
NCBI Official Synonym Full Names
ubiquitin conjugating enzyme E2 E2
NCBI Official Symbol
UBE2E2
NCBI Official Synonym Symbols
UBCH8
NCBI Protein Information
ubiquitin-conjugating enzyme E2 E2
UniProt Protein Name
Ubiquitin-conjugating enzyme E2 E2
UniProt Gene Name
UBE2E2
UniProt Synonym Gene Names
UBCH8
UniProt Entry Name
UB2E2_HUMAN

Uniprot Description

UBE2E2: Accepts ubiquitin from the E1 complex and catalyzes its covalent attachment to other proteins. In vitro catalyzes 'Lys- 11'- and 'Lys-48'-, as well as 'Lys-63'-linked polyubiquitination. Belongs to the ubiquitin-conjugating enzyme family.

Protein type: EC 6.3.2.19; Ubiquitin ligase; Ubiquitin conjugating system; Ligase

Chromosomal Location of Human Ortholog: 3p24.2

Molecular Function: ISG15 conjugating enzyme activity; protein binding; ubiquitin-protein ligase activity

Biological Process: ISG15-protein conjugation; response to DNA damage stimulus

Research Articles on UBE2E2

Similar Products

Product Notes

The UBE2E2 ube2e2 (Catalog #AAA1275412) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtccactg aggcacaaag agttgatgac agtccaagca ctagtggagg aagttccgat ggagatcaac gtgaaagtgt tcagcaagaa ccagaaagag aacaagttca gcccaagaaa aaggagggaa aaatatccag caaaaccgct gctaaattgt caactagtgc taaaagaatt cagaaggaac ttgcagaaat cacattggac cctcctccca actgtagtgc tggacccaaa ggagacaaca tttatgaatg gaggtcaact atattgggac ccccaggatc tgtctatgaa ggaggggtgt tctttcttga cattaccttt tcaccagact atccgtttaa accccctaag gttaccttcc gaacaagaat ctatcactgt aatattaaca gccaaggtgt gatctgtctg gacatcttaa aggacaactg gagtccggct ttaactattt ctaaagttct cctctccatc tgctcacttc ttacagattg caaccctgct gaccctctgg tgggcagcat cgccacacag tacatgacca acagagcaga gcatgaccgg atggccagac agtggaccaa gcggtacgcc acatag. It is sometimes possible for the material contained within the vial of "UBE2E2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.