Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SOX6 cdna clone

SOX6 cDNA Clone

Gene Names
SOX6; SOXD; HSSOX6
Synonyms
SOX6; SOX6 cDNA Clone; SOX6 cdna clone
Ordering
For Research Use Only!
Sequence
atgaaaggtcatggtgagcttcaaggacatgaaagaagaatgtcttccaagcaagccacctctccatttgcctgtgcagctgatggagaggatgcaatgacccaggatttaacctcaagggaaaaggaagagggcagtgatcaacatgtggcctcccatctgcctctgcaccccataatgcacaacaaacctcactctgaggagctaccaacacttgtcagtaccattcaacaagatgctgactgggacagcgttctgtcatctcagcaaagaatggaatcagagaataataagttatgttccctatattccttccgaaatacctctacctcaccacataagcctgacgaagggagtcgggaccgtgagataatgaccagtgttacttttggaaccccagagcgccgcaaagggagtcttgccgatgtggtggacacactgaaacagaagaagcttgaggaaatgactcggactgaacaagaggattcctcctgcatggaaaaactactttcaaaagattggaaggaaaaaatggaaagactaaataccagtgaacttcttggagaaattaaaggtacacctgagagcctggcagaaaaagaacggcagctctccaccatgattacccagctgatcagtttacgggagcagctactggcagcgcatgatgaacagaaaaaactggcagcgtcacaaattgagaaacaacggcagcaaatggaccttgctcgccaacagcaagaacagattgcgagacaacagcagcaacttctgcaacagcagcacaaaattaatctcctgcagcaacagatccaggttcagggtcacatgcctccgctcatgatcccaatttttccacatgaccagcggaccctggcagcagctgctgctgcccaacagggattcctcttcccccctggaataacatacaaaccaggtgataactaccccgtacagttcattccatcaacaatggcagctgctgctgcttctggactcagccctttacagctccagaagggtcatgtctcccacccacaaattaaccaaaggctaaagggcctaagtgaccgttttggcaggaatttggacacctttgaacatggtggtggccactcttacaaccacaaacagattgagcagctctatgccgctcagctggccagcatgcaggtgtcacctggagcaaagatgccatcaactccacagccaccaaacacagcagggacggtctcacctactgggataaaaaatgaaaagagagggaccagccctgtaactcaagttaaggatgaagcagcagcacagcctctgaatctctcatcccgacccaagacagcagagcctgtaaagtccccaacgtctcccacccagaacctcttcccagccagcaaaaccagccctgtcaatctgccaaacaaaagcagcatccctagccccattggaggaagcctgggaagaggatcctctttagatatcctatctagtctcaactcccctgccctttttggggatcaggatacagtgatgaaagccattcaggaggcgcggaagatgcgagagcagatccagcgggagcaacagcagcaacagccacatggtgttgacgggaaactgtcctccataaataatatggggctgaacagctgcaggaatgaaaaggaaagaacgcgctttgagaatttggggccccagttaacgggaaagtcaaatgaagatggaaaactgggcccaggtgtcatcgaccttactcggccagaagatgcagagggaagtaaagcaatgaatggctctgcagctaaactacagcagtattattgttggccaacaggaggtgccactgtggctgaagcacgagtctacagggacgcccgcggccgtgccagcagcgagccacacattaagcgaccaatgaatgcattcatggtttgggcaaaggatgagaggagaaaaatccttcaggccttccccgacatgcataactccaacattagcaaaatcttaggatctcgctggaaatcaatgtccaaccaggagaagcaaccttattatgaagagcaggcccggctaagcaagatccacttagagaagtacccaaactataaatacaaaccccgaccgaaacgcacctgcattgttgatggcaaaaagcttcggattggggagtataagcaactgatgaggtctcggagacaggagatgaggcagttctttactgtggggcaacagcctcagattccaatcaccacaggaacaggtgttgtgtatcctggtgctatcactatggcaactaccacaccatcgcctcagatgacatctgactgctctagcacctcggccagcccggagcccagcctcccggtcatccagagcacttatggtatgaagacagatggcggaagcctagctggaaatgaaatgatcaatggagaggatgaaatggaaatgtatgatgactatgaagatgaccccaaatcagactatagcagtgaaaatgaagccccggaggctgtcagtgccaactga
Sequence Length
2526
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
88,988 Da
NCBI Official Full Name
Homo sapiens SRY (sex determining region Y)-box 6, mRNA
NCBI Official Synonym Full Names
SRY-box 6
NCBI Official Symbol
SOX6
NCBI Official Synonym Symbols
SOXD; HSSOX6
NCBI Protein Information
transcription factor SOX-6
UniProt Protein Name
Transcription factor SOX-6
Protein Family
UniProt Gene Name
SOX6
UniProt Entry Name
SOX6_HUMAN

NCBI Description

This gene encodes a member of the D subfamily of sex determining region y-related transcription factors that are characterized by a conserved DNA-binding domain termed the high mobility group box and by their ability to bind the minor groove of DNA. The encoded protein is a transcriptional activator that is required for normal development of the central nervous system, chondrogenesis and maintenance of cardiac and skeletal muscle cells. The encoded protein interacts with other family members to cooperatively activate gene expression. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Mar 2009]

Uniprot Description

SOX6: Transcriptional activator. Binds specifically to the DNA sequence 5'-AACAAT-3'. Plays a key role in several developmental processes, including neurogenesis and skeleton formation. 4 isoforms of the human protein are produced by alternative splicing.

Protein type: DNA-binding

Chromosomal Location of Human Ortholog: 11p15.3

Cellular Component: nucleoplasm; nucleus

Molecular Function: protein binding

Biological Process: positive regulation of chondrocyte differentiation

Research Articles on SOX6

Similar Products

Product Notes

The SOX6 sox6 (Catalog #AAA1275361) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaaaggtc atggtgagct tcaaggacat gaaagaagaa tgtcttccaa gcaagccacc tctccatttg cctgtgcagc tgatggagag gatgcaatga cccaggattt aacctcaagg gaaaaggaag agggcagtga tcaacatgtg gcctcccatc tgcctctgca ccccataatg cacaacaaac ctcactctga ggagctacca acacttgtca gtaccattca acaagatgct gactgggaca gcgttctgtc atctcagcaa agaatggaat cagagaataa taagttatgt tccctatatt ccttccgaaa tacctctacc tcaccacata agcctgacga agggagtcgg gaccgtgaga taatgaccag tgttactttt ggaaccccag agcgccgcaa agggagtctt gccgatgtgg tggacacact gaaacagaag aagcttgagg aaatgactcg gactgaacaa gaggattcct cctgcatgga aaaactactt tcaaaagatt ggaaggaaaa aatggaaaga ctaaatacca gtgaacttct tggagaaatt aaaggtacac ctgagagcct ggcagaaaaa gaacggcagc tctccaccat gattacccag ctgatcagtt tacgggagca gctactggca gcgcatgatg aacagaaaaa actggcagcg tcacaaattg agaaacaacg gcagcaaatg gaccttgctc gccaacagca agaacagatt gcgagacaac agcagcaact tctgcaacag cagcacaaaa ttaatctcct gcagcaacag atccaggttc agggtcacat gcctccgctc atgatcccaa tttttccaca tgaccagcgg accctggcag cagctgctgc tgcccaacag ggattcctct tcccccctgg aataacatac aaaccaggtg ataactaccc cgtacagttc attccatcaa caatggcagc tgctgctgct tctggactca gccctttaca gctccagaag ggtcatgtct cccacccaca aattaaccaa aggctaaagg gcctaagtga ccgttttggc aggaatttgg acacctttga acatggtggt ggccactctt acaaccacaa acagattgag cagctctatg ccgctcagct ggccagcatg caggtgtcac ctggagcaaa gatgccatca actccacagc caccaaacac agcagggacg gtctcaccta ctgggataaa aaatgaaaag agagggacca gccctgtaac tcaagttaag gatgaagcag cagcacagcc tctgaatctc tcatcccgac ccaagacagc agagcctgta aagtccccaa cgtctcccac ccagaacctc ttcccagcca gcaaaaccag ccctgtcaat ctgccaaaca aaagcagcat ccctagcccc attggaggaa gcctgggaag aggatcctct ttagatatcc tatctagtct caactcccct gccctttttg gggatcagga tacagtgatg aaagccattc aggaggcgcg gaagatgcga gagcagatcc agcgggagca acagcagcaa cagccacatg gtgttgacgg gaaactgtcc tccataaata atatggggct gaacagctgc aggaatgaaa aggaaagaac gcgctttgag aatttggggc cccagttaac gggaaagtca aatgaagatg gaaaactggg cccaggtgtc atcgacctta ctcggccaga agatgcagag ggaagtaaag caatgaatgg ctctgcagct aaactacagc agtattattg ttggccaaca ggaggtgcca ctgtggctga agcacgagtc tacagggacg cccgcggccg tgccagcagc gagccacaca ttaagcgacc aatgaatgca ttcatggttt gggcaaagga tgagaggaga aaaatccttc aggccttccc cgacatgcat aactccaaca ttagcaaaat cttaggatct cgctggaaat caatgtccaa ccaggagaag caaccttatt atgaagagca ggcccggcta agcaagatcc acttagagaa gtacccaaac tataaataca aaccccgacc gaaacgcacc tgcattgttg atggcaaaaa gcttcggatt ggggagtata agcaactgat gaggtctcgg agacaggaga tgaggcagtt ctttactgtg gggcaacagc ctcagattcc aatcaccaca ggaacaggtg ttgtgtatcc tggtgctatc actatggcaa ctaccacacc atcgcctcag atgacatctg actgctctag cacctcggcc agcccggagc ccagcctccc ggtcatccag agcacttatg gtatgaagac agatggcgga agcctagctg gaaatgaaat gatcaatgga gaggatgaaa tggaaatgta tgatgactat gaagatgacc ccaaatcaga ctatagcagt gaaaatgaag ccccggaggc tgtcagtgcc aactga. It is sometimes possible for the material contained within the vial of "SOX6, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.