Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

JMJD6 cdna clone

JMJD6 cDNA Clone

Gene Names
JMJD6; PSR; PTDSR; PTDSR1
Synonyms
JMJD6; JMJD6 cDNA Clone; JMJD6 cdna clone
Ordering
For Research Use Only!
Sequence
atgaaccacaagagcaagaagcgcatccgcgaggccaagcggagtgcgcggccggagctcaaggactcgctggattggacccggcacaactactacgagagcttctcgctgagcccggcggccgtggcggataacgtggaaagggcagatgctttacagctgtctgtggaagaatttgtggagcggtatgaaagaccttacaagcccgtggttttgttgaatgcgcaagagggctggtctgcgcaggagaaatggactctggagcgcctaaaaaggaaatatcggaaccagaagttcaagtgtggtgaggataacgatggctactcagtgaagatgaagatgaaatactacatcgagtacatggagagcactcgagatgatagtcccctttacatctttgacagcagctatggtgaacaccctaaaagaaggaaacttttggaagactacaaggtgccaaagtttttcactgatgaccttttccagtatgctggggagaagcgcaggcccccttacaggtggtttgtgatggggccaccacgctccggaactgggattcacatcgaccctctgggaaccagtgcctggaatgccttagttcagggccacaagcgctggtgcctgtttcctaccagcactcccagggaactcatcaaagtgacccgagacgaaggagggaaccagcaagacgaagctattacctggtttaatgttatttatccccggacacagcttccaacctggccacctgaattcaaacccctggaaatcttacaaaaaccaggagagactgtctttgtaccaggaggctggtggcatgttgtcctcaatctcgacactactatcgccatcacccaaaattttgccagcagcaccaacttccctgtggtatggcacaagacggtaagagggagaccaaagttatcaaggaaatggtataggattttgaagcaagagcaccccgagttggcagtcctcgcagactcggttgaccttcaggagtccacagggatagcttccgacagctccagcgactcttccagctcctccagctccagttcgtcagactccgactcagagtgcgagtctggatccgagggcgatgggacagtgcaccgcaggaagaagaggaggacgtgcagcatggtgggaaacggggacaccacctcccaggacgactgtgtcagcaaagagcgcagctcctccaggtga
Sequence Length
1212
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
47,626 Da
NCBI Official Full Name
Homo sapiens jumonji domain containing 6, mRNA
NCBI Official Synonym Full Names
arginine demethylase and lysine hydroxylase
NCBI Official Symbol
JMJD6
NCBI Official Synonym Symbols
PSR; PTDSR; PTDSR1
NCBI Protein Information
bifunctional arginine demethylase and lysyl-hydroxylase JMJD6
UniProt Protein Name
Bifunctional arginine demethylase and lysyl-hydroxylase JMJD6
UniProt Gene Name
JMJD6
UniProt Synonym Gene Names
KIAA0585; PTDSR; Protein PTDSR
UniProt Entry Name
JMJD6_HUMAN

NCBI Description

This gene encodes a nuclear protein with a JmjC domain. JmjC domain-containing proteins are predicted to function as protein hydroxylases or histone demethylases. This protein was first identified as a putative phosphatidylserine receptor involved in phagocytosis of apoptotic cells; however, subsequent studies have indicated that it does not directly function in the clearance of apoptotic cells, and questioned whether it is a true phosphatidylserine receptor. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]

Uniprot Description

JMJD6: Dioxygenase that can both act as a histone arginine demethylase and a lysyl-hydroxylase. Acts as a lysyl-hydroxylase that catalyzes 5-hydroxylation on specific lysine residues of target proteins such as U2AF2/U2AF65 and LUC7L2. Acts as a regulator of RNA splicing by mediating 5-hydroxylation of U2AF2/U2AF65, affecting the pre-mRNA splicing activity of U2AF2/U2AF65. In addition to peptidyl-lysine 5-dioxygenase activity, may act as a RNA hydroxylase, as suggested by its ability to bind single strand RNA. Also acts as an arginine demethylase which demethylates histone H3 at 'Arg-2' (H3R2me) and histone H4 at 'Arg-3' (H4R3me), thereby playing a role in histone code. However, histone arginine demethylation may not constitute the primary activity in vivo. Has no histone lysine demethylase activity. Required for differentiation of multiple organs during embryogenesis. Acts as a key regulator of hematopoietic differentiation: required for angiogenic sprouting by regulating the pre-mRNA splicing activity of U2AF2/U2AF65. Seems to be necessary for the regulation of macrophage cytokine responses. Belongs to the JMJD6 family. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: Oxidoreductase; Apoptosis; Cell development/differentiation; Receptor, misc.; EC 1.14.11.-; Nucleolus

Chromosomal Location of Human Ortholog: 17q25

Cellular Component: nucleolus; nucleoplasm; nucleus

Molecular Function: histone demethylase activity; histone demethylase activity (H3-R2 specific); histone demethylase activity (H4-R3 specific); identical protein binding; iron ion binding; protein binding; RNA binding; single-stranded RNA binding

Biological Process: peptidyl-lysine hydroxylation to 5-hydroxy-L-lysine; regulation of nuclear mRNA splicing, via spliceosome; sprouting angiogenesis

Research Articles on JMJD6

Similar Products

Product Notes

The JMJD6 jmjd6 (Catalog #AAA1275318) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgaaccaca agagcaagaa gcgcatccgc gaggccaagc ggagtgcgcg gccggagctc aaggactcgc tggattggac ccggcacaac tactacgaga gcttctcgct gagcccggcg gccgtggcgg ataacgtgga aagggcagat gctttacagc tgtctgtgga agaatttgtg gagcggtatg aaagacctta caagcccgtg gttttgttga atgcgcaaga gggctggtct gcgcaggaga aatggactct ggagcgccta aaaaggaaat atcggaacca gaagttcaag tgtggtgagg ataacgatgg ctactcagtg aagatgaaga tgaaatacta catcgagtac atggagagca ctcgagatga tagtcccctt tacatctttg acagcagcta tggtgaacac cctaaaagaa ggaaactttt ggaagactac aaggtgccaa agtttttcac tgatgacctt ttccagtatg ctggggagaa gcgcaggccc ccttacaggt ggtttgtgat ggggccacca cgctccggaa ctgggattca catcgaccct ctgggaacca gtgcctggaa tgccttagtt cagggccaca agcgctggtg cctgtttcct accagcactc ccagggaact catcaaagtg acccgagacg aaggagggaa ccagcaagac gaagctatta cctggtttaa tgttatttat ccccggacac agcttccaac ctggccacct gaattcaaac ccctggaaat cttacaaaaa ccaggagaga ctgtctttgt accaggaggc tggtggcatg ttgtcctcaa tctcgacact actatcgcca tcacccaaaa ttttgccagc agcaccaact tccctgtggt atggcacaag acggtaagag ggagaccaaa gttatcaagg aaatggtata ggattttgaa gcaagagcac cccgagttgg cagtcctcgc agactcggtt gaccttcagg agtccacagg gatagcttcc gacagctcca gcgactcttc cagctcctcc agctccagtt cgtcagactc cgactcagag tgcgagtctg gatccgaggg cgatgggaca gtgcaccgca ggaagaagag gaggacgtgc agcatggtgg gaaacgggga caccacctcc caggacgact gtgtcagcaa agagcgcagc tcctccaggt ga. It is sometimes possible for the material contained within the vial of "JMJD6, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.