Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

TRIM23 cdna clone

TRIM23 cDNA Clone

Gene Names
TRIM23; ARD1; ARFD1; RNF46
Synonyms
TRIM23; TRIM23 cDNA Clone; TRIM23 cdna clone
Ordering
For Research Use Only!
Sequence
atggctaccctggttgtaaacaagctcggagcgggagtagacagtggccggcagggcagccgggggacagctgtagtgaaggtgctagagtgtggagtttgtgaagatgtcttttctttgcaaggagacaaagttccccgtcttttgctttgtggccataccgtctgtcatgactgtctcactcgcctacctcttcatggaagagcaatccgttgcccatttgatcgacaagtaacagacctaggtgattcaggtgtctggggattgaaaaaaaattttgctttattggagcttttggaacgactgcagaatgggcctattggtcagtatggagctgcagaagaatccattgggatatctggagagagcatcattcgttgtgatgaagatgaagctcaccttgcctctgtatattgcactgtgtgtgcaactcatttgtgctctgagtgttctcaagttactcattctacaaagacattagcaaagcacaggcgagttcctctagctgataaacctcatgagaaaactatgtgctctcagcaccaggtgcatgccattgagtttgtttgcttggaagaaggttgtcaaactagcccactcatgtgctgtgtctgcaaagaatatggaaaacaccagggtcacaagcattcagtattggaaccagaagctaatcagatccgagcatcaattttagatatggctcactgcatacggaccttcacagaggaaatctcagattattccagaaaattagttggaattgtgcagcacattgaaggaggagaacaaatcgtggaagatggaattggaatggctcacacagaacatgtaccagggactgcagagaatgcccggtcatgtattcgagcttatttttatgatctacatgaaactctgtgtcgtcaagaagaaatggctctaagtgttgttgatgctcatgttcgtgaaaaattgatttggctcaggcagcaacaagaagatatgactattttgttgtcagaggtttctgcagcctgcctccactgtgaaaagactttgcagcaggatgattgtagagttgtcttggcaaaacaggaaattacaaggttactggaaacattgcagaaacagcagcagcagtttacagaagttgcagatcacattcagttggatgccagcatccctgtcacttttacaaaggataatcgagttcacattggaccaaaaatggaaattcgggtcgttacgttaggattggatggtgctggaaaaactactatcttgtttaagttaaaacaggatgaattcatgcagcccattccaacaattggttttaacgtggaaactgtagaatataaaaatctaaaattcactatttgggatgtaggtggaaaacacaaattaagaccattgtggaaacattattacctcaatactcaagctgttgtgtttgttgtagatagcagtcatagagacagaattagtgaagcacacagcgaacttgcaaagttgttaacggaaaaagaactccgagatgctctgctcctgatttttgctaacaaacaggatgttgctggagcactgtcagtagaagaaatcactgaactactcagtctccataaattatgctgtggccgtagctggtatattcagggctgtgatgctcgaagtggtatgggactgtatgaagggttggactggctctcacggcaacttgtagctgctggagtattggatgttgcttga
Sequence Length
1725
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
373
Molecular Weight
61,068 Da
NCBI Official Full Name
Homo sapiens tripartite motif-containing 23, mRNA
NCBI Official Synonym Full Names
tripartite motif containing 23
NCBI Official Symbol
TRIM23
NCBI Official Synonym Symbols
ARD1; ARFD1; RNF46
NCBI Protein Information
E3 ubiquitin-protein ligase TRIM23
UniProt Protein Name
E3 ubiquitin-protein ligase TRIM23
UniProt Gene Name
TRIM23
UniProt Synonym Gene Names
ARD1; ARFD1; RNF46
UniProt Entry Name
TRI23_HUMAN

NCBI Description

The protein encoded by this gene is a member of the tripartite motif (TRIM) family. The TRIM motif includes three zinc-binding domains, a RING, a B-box type 1 and a B-box type 2, and a coiled-coil region. This protein is also a member of the ADP ribosylation factor family of guanine nucleotide-binding family of proteins. Its carboxy terminus contains an ADP-ribosylation factor domain and a guanine nucleotide binding site, while the amino terminus contains a GTPase activating protein domain which acts on the guanine nucleotide binding site. The protein localizes to lysosomes and the Golgi apparatus. It plays a role in the formation of intracellular transport vesicles, their movement from one compartment to another, and phopholipase D activation. Three alternatively spliced transcript variants for this gene have been described. [provided by RefSeq, Jul 2008]

Uniprot Description

TRIM23: Acts as an E3 ubiquitin-protein ligase. In the presence of the human cytomegalovirus (HCMV) protein UL144, participates in 'Lys-63'-linked auto-ubiquitination of TRAF6 resulting in the virally controlled activation of NF-kappa-B at early time of infection. The C-terminus can act as an allosteric activator of the cholera toxin catalytic subunit. 3 isoforms of the human protein are produced by alternative splicing.

Protein type: Ubiquitin ligase; Ubiquitin conjugating system; Ligase; EC 6.3.2.-

Chromosomal Location of Human Ortholog: 5q12.3

Cellular Component: Golgi membrane; lysosomal membrane

Molecular Function: enzyme activator activity; GDP binding; GTP binding; GTPase activity; identical protein binding; protein binding; ubiquitin-protein ligase activity

Biological Process: protein ubiquitination

Research Articles on TRIM23

Similar Products

Product Notes

The TRIM23 trim23 (Catalog #AAA1275294) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggctaccc tggttgtaaa caagctcgga gcgggagtag acagtggccg gcagggcagc cgggggacag ctgtagtgaa ggtgctagag tgtggagttt gtgaagatgt cttttctttg caaggagaca aagttccccg tcttttgctt tgtggccata ccgtctgtca tgactgtctc actcgcctac ctcttcatgg aagagcaatc cgttgcccat ttgatcgaca agtaacagac ctaggtgatt caggtgtctg gggattgaaa aaaaattttg ctttattgga gcttttggaa cgactgcaga atgggcctat tggtcagtat ggagctgcag aagaatccat tgggatatct ggagagagca tcattcgttg tgatgaagat gaagctcacc ttgcctctgt atattgcact gtgtgtgcaa ctcatttgtg ctctgagtgt tctcaagtta ctcattctac aaagacatta gcaaagcaca ggcgagttcc tctagctgat aaacctcatg agaaaactat gtgctctcag caccaggtgc atgccattga gtttgtttgc ttggaagaag gttgtcaaac tagcccactc atgtgctgtg tctgcaaaga atatggaaaa caccagggtc acaagcattc agtattggaa ccagaagcta atcagatccg agcatcaatt ttagatatgg ctcactgcat acggaccttc acagaggaaa tctcagatta ttccagaaaa ttagttggaa ttgtgcagca cattgaagga ggagaacaaa tcgtggaaga tggaattgga atggctcaca cagaacatgt accagggact gcagagaatg cccggtcatg tattcgagct tatttttatg atctacatga aactctgtgt cgtcaagaag aaatggctct aagtgttgtt gatgctcatg ttcgtgaaaa attgatttgg ctcaggcagc aacaagaaga tatgactatt ttgttgtcag aggtttctgc agcctgcctc cactgtgaaa agactttgca gcaggatgat tgtagagttg tcttggcaaa acaggaaatt acaaggttac tggaaacatt gcagaaacag cagcagcagt ttacagaagt tgcagatcac attcagttgg atgccagcat ccctgtcact tttacaaagg ataatcgagt tcacattgga ccaaaaatgg aaattcgggt cgttacgtta ggattggatg gtgctggaaa aactactatc ttgtttaagt taaaacagga tgaattcatg cagcccattc caacaattgg ttttaacgtg gaaactgtag aatataaaaa tctaaaattc actatttggg atgtaggtgg aaaacacaaa ttaagaccat tgtggaaaca ttattacctc aatactcaag ctgttgtgtt tgttgtagat agcagtcata gagacagaat tagtgaagca cacagcgaac ttgcaaagtt gttaacggaa aaagaactcc gagatgctct gctcctgatt tttgctaaca aacaggatgt tgctggagca ctgtcagtag aagaaatcac tgaactactc agtctccata aattatgctg tggccgtagc tggtatattc agggctgtga tgctcgaagt ggtatgggac tgtatgaagg gttggactgg ctctcacggc aacttgtagc tgctggagta ttggatgttg cttga. It is sometimes possible for the material contained within the vial of "TRIM23, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.