Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

SLC13A3 cdna clone

SLC13A3 cDNA Clone

Gene Names
SLC13A3; NADC3; SDCT2
Synonyms
SLC13A3; SLC13A3 cDNA Clone; SLC13A3 cdna clone
Ordering
For Research Use Only!
Sequence
atggcggcgctggcagcagcggccaagaaggtgtggagcgcgcggcggctgctggtgctgctgttcacgccgctcgcgctgctgccggtggtcttcgccctcccgcccaaggaaggccgctgcttgtttgtcatcctgctcatggcggtgtactggtgcacggaggccctgccgctctcagtgacggcgctgctgcccatcgtcctgttccccttcatgggcatcttgccctccaacaaggtctgcccccagtacttcctcgacaccaacttcctcttcctcagtgggctgatcatggccagcgccattgaggagtggaacctgcaccggcgaatcgccctcaagatcctgatgcttgttggagtccagccggccaggctcatcctggggatgatggtgaccacctcgttcttgtccatgtggctgagcaacaccgcctccactgccatgatgcttcccattgccaatgccatcctgaaaagtctctttggccagaaggaggttcgaaaggaccccagccaggagagtgaagagaacacagctgctgtgcggagaaacggcctacacactgtgcccacggagatgcagtttctcgccagcacagaagccaaagaccaccctggggagacagaggttccactggatctgccggctgactccaggaaggaggatgaatatcgtcggaacatctggaagggcttcctcatctccatcccctactcagccagtattgggggcacagccacactcacgggcacagcccctaacctcatcctgcttggccagctcaagagtttctttccgcagtgtgacgtggtgaatttcggctcctggttcattttcgccttccctcttatgctgttgttcctgttggcaggctggctctggatctccttcctgtacgggggactgagcttcaggggctggaggaagaataaatctgagataagaaccaatgcagaagatagggctcgagctgtaattcgggaagaataccagaacctggggcccatcaagtttgccgaacaggctgttttcatccttttctgcatgtttgccatcctcctcttcacccgggacccgaagttcgtccctggctgggccagcctcttcaatcctgggtttctttctgatgctgtcaccggcgtggctattgtcaccatcttgttcttcttcccgtcccaaaggccctctctcaagtggtggtttgacttcaaagctcccaacacagagacagagcccttgctgacctggaagaaggcccaggagacagtgccctggaacatcatccttctcctgggagggggcttcgccatggccaaaggctgtgaggaatcggggctgtctgtatggattggtgggcagctgcaccccctggagaatgtgccccccgccctggctgtgctgctcatcactgtggtcatcgccttcttcactgagtttgccagcaacacggcgaccatcatcatcttcctgccggtcctggcagagctggccatccgcctgagagtgcaccccctgtatctgatgattccgggcacagtcggctgctcctttgccttcatgctcccggtctcaacgccccccaactccatcgccttcgcctctggacacttgctggtcaaagacatggtgcggacaggcctcctgatgaacctgatgggtgtcctgctgctcagtttggctatgaatacctgggcacagaccatcttccagctgggcaccttcccggactgggctgatatgtactcggtcaatgtcacagcattgccacccaccttggccaatgacacatttcggaccctctga
Sequence Length
1809
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
61,757 Da
NCBI Official Full Name
Homo sapiens solute carrier family 13 (sodium-dependent dicarboxylate transporter), member 3, mRNA
NCBI Official Synonym Full Names
solute carrier family 13 member 3
NCBI Official Symbol
SLC13A3
NCBI Official Synonym Symbols
NADC3; SDCT2
NCBI Protein Information
solute carrier family 13 member 3
UniProt Protein Name
Solute carrier family 13 member 3
Protein Family
UniProt Gene Name
SLC13A3
UniProt Synonym Gene Names
NADC3; SDCT2; NaDC-3; hNaDC3
UniProt Entry Name
S13A3_HUMAN

NCBI Description

Mammalian sodium-dicarboxylate cotransporters transport succinate and other Krebs cycle intermediates. They fall into 2 categories based on their substrate affinity: low affinity and high affinity. Both the low- and high-affinity transporters play an important role in the handling of citrate by the kidneys. The protein encoded by this gene represents the high-affinity form. Alternatively spliced transcript variants encoding different isoforms have been found for this gene, although the full-length nature of some of them have not been characterized yet. [provided by RefSeq, Jul 2008]

Uniprot Description

SLC13A3: High-affinity sodium-dicarboxylate cotransporter that accepts a range of substrates with 4-5 carbon atoms. The stoichiometry is probably 3 Na(+) for 1 divalent succinate. Belongs to the SLC13A/DASS transporter (TC 2.A.47) family. NADC subfamily. 4 isoforms of the human protein are produced by alternative splicing.

Protein type: Transporter, SLC family; Membrane protein, multi-pass; Membrane protein, integral; Transporter

Chromosomal Location of Human Ortholog: 20q13.12

Cellular Component: integral to plasma membrane; plasma membrane

Molecular Function: citrate transmembrane transporter activity; high affinity sodium:dicarboxylate symporter activity; sodium:dicarboxylate symporter activity; succinate transmembrane transporter activity

Biological Process: citrate transport

Research Articles on SLC13A3

Similar Products

Product Notes

The SLC13A3 slc13a3 (Catalog #AAA1275286) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcggcgc tggcagcagc ggccaagaag gtgtggagcg cgcggcggct gctggtgctg ctgttcacgc cgctcgcgct gctgccggtg gtcttcgccc tcccgcccaa ggaaggccgc tgcttgtttg tcatcctgct catggcggtg tactggtgca cggaggccct gccgctctca gtgacggcgc tgctgcccat cgtcctgttc cccttcatgg gcatcttgcc ctccaacaag gtctgccccc agtacttcct cgacaccaac ttcctcttcc tcagtgggct gatcatggcc agcgccattg aggagtggaa cctgcaccgg cgaatcgccc tcaagatcct gatgcttgtt ggagtccagc cggccaggct catcctgggg atgatggtga ccacctcgtt cttgtccatg tggctgagca acaccgcctc cactgccatg atgcttccca ttgccaatgc catcctgaaa agtctctttg gccagaagga ggttcgaaag gaccccagcc aggagagtga agagaacaca gctgctgtgc ggagaaacgg cctacacact gtgcccacgg agatgcagtt tctcgccagc acagaagcca aagaccaccc tggggagaca gaggttccac tggatctgcc ggctgactcc aggaaggagg atgaatatcg tcggaacatc tggaagggct tcctcatctc catcccctac tcagccagta ttgggggcac agccacactc acgggcacag cccctaacct catcctgctt ggccagctca agagtttctt tccgcagtgt gacgtggtga atttcggctc ctggttcatt ttcgccttcc ctcttatgct gttgttcctg ttggcaggct ggctctggat ctccttcctg tacgggggac tgagcttcag gggctggagg aagaataaat ctgagataag aaccaatgca gaagataggg ctcgagctgt aattcgggaa gaataccaga acctggggcc catcaagttt gccgaacagg ctgttttcat ccttttctgc atgtttgcca tcctcctctt cacccgggac ccgaagttcg tccctggctg ggccagcctc ttcaatcctg ggtttctttc tgatgctgtc accggcgtgg ctattgtcac catcttgttc ttcttcccgt cccaaaggcc ctctctcaag tggtggtttg acttcaaagc tcccaacaca gagacagagc ccttgctgac ctggaagaag gcccaggaga cagtgccctg gaacatcatc cttctcctgg gagggggctt cgccatggcc aaaggctgtg aggaatcggg gctgtctgta tggattggtg ggcagctgca ccccctggag aatgtgcccc ccgccctggc tgtgctgctc atcactgtgg tcatcgcctt cttcactgag tttgccagca acacggcgac catcatcatc ttcctgccgg tcctggcaga gctggccatc cgcctgagag tgcaccccct gtatctgatg attccgggca cagtcggctg ctcctttgcc ttcatgctcc cggtctcaac gccccccaac tccatcgcct tcgcctctgg acacttgctg gtcaaagaca tggtgcggac aggcctcctg atgaacctga tgggtgtcct gctgctcagt ttggctatga atacctgggc acagaccatc ttccagctgg gcaccttccc ggactgggct gatatgtact cggtcaatgt cacagcattg ccacccacct tggccaatga cacatttcgg accctctga. It is sometimes possible for the material contained within the vial of "SLC13A3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.