Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CCRL2 cdna clone

CCRL2 cDNA Clone

Gene Names
CCRL2; HCR; CKRX; CRAM; ACKR5; CRAM-A; CRAM-B
Synonyms
CCRL2; CCRL2 cDNA Clone; CCRL2 cdna clone
Ordering
For Research Use Only!
Sequence
atggccaattacacgctggcaccagaggatgaatatgatgtcctcatagaaggtgaactggagagcgatgaggcagagcaatgtgacaagtatgacgcccaggcactctcagcccagctggtgccatcactctgctctgctgtgtttgtgatcggtgtcctggacaatctcctggttgtgcttatcctggtaaaatataaaggactcaaacgcgtggaaaatatctatcttctaaacttggcagtttctaacttgtgtttcttgcttaccctgcccttctgggctcatgctgggggcgatcccatgtgtaaaattctcattggactgtacttcgtgggcctgtacagtgagacatttttcaattgccttctgactgtgcaaaggtacctagtgtttttgcacaagggaaactttttctcagccaggaggagggtgccctgtggcatcattacaagtgtcctggcatgggtaacagccattctggccactttgcctgaattcgtggtttataaacctcagatggaagaccagaaatacaagtgtgcatttagcagaactcccttcctgccagctgatgagacattctggaagcattttctgactttaaaaatgaacatttcggttcttgtcctccccctatttatttttacatttctctatgtgcaaatgagaaaaacactaaggttcagggagcagaggtatagccttttcaagcttgtttttgccataatggtagtcttccttctgatgtgggcgccctacaatattgcatttttcctgtccactttcaaagaacacttctccctgagtgactgcaagagcagctacaatctggacaaaagtgttcacatcactaaactcatcgccaccacccactgctgcatcaaccctctcctgtatgcgtttcttgatgggacatttagcaaatacctctgccgctgtttccatctgcgtagtaacaccccacttcaacccagggggcagtctgcacaaggcacatcgagggaagaacctgaccattccaccgaagtgtaa
Sequence Length
1035
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
40,952 Da
NCBI Official Full Name
Homo sapiens chemokine (C-C motif) receptor-like 2, mRNA
NCBI Official Synonym Full Names
C-C motif chemokine receptor like 2
NCBI Official Symbol
CCRL2
NCBI Official Synonym Symbols
HCR; CKRX; CRAM; ACKR5; CRAM-A; CRAM-B
NCBI Protein Information
C-C chemokine receptor-like 2
UniProt Protein Name
C-C chemokine receptor-like 2
Protein Family
UniProt Gene Name
CCRL2
UniProt Synonym Gene Names
CCR11; CCR6; CKRX; CRAM; HCR
UniProt Entry Name
CCRL2_HUMAN

NCBI Description

This gene encodes a chemokine receptor like protein, which is predicted to be a seven transmembrane protein and most closely related to CCR1. Chemokines and their receptors mediated signal transduction are critical for the recruitment of effector immune cells to the site of inflammation. This gene is expressed at high levels in primary neutrophils and primary monocytes, and is further upregulated on neutrophil activation and during monocyte to macrophage differentiation. The function of this gene is unknown. This gene is mapped to the region where the chemokine receptor gene cluster is located. [provided by RefSeq, Jul 2008]

Uniprot Description

CCRL2: Receptor for CCL19 and chemerin/RARRES2. Does not appear to be a signaling receptor, but may have a role in modulating chemokine-triggered immune responses by capturing and internalizing CCL19 or by presenting RARRES2 ligand to CMKLR1, a functional signaling receptors. Plays a critical role for the development of Th2 responses. Belongs to the G-protein coupled receptor 1 family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: GPCR, family 1; Membrane protein, integral; Membrane protein, multi-pass; Receptor, GPCR

Chromosomal Location of Human Ortholog: 3p21

Cellular Component: integral to plasma membrane; plasma membrane

Molecular Function: CCR chemokine receptor binding; chemokine receptor binding

Biological Process: inflammatory response

Research Articles on CCRL2

Similar Products

Product Notes

The CCRL2 ccrl2 (Catalog #AAA1275266) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggccaatt acacgctggc accagaggat gaatatgatg tcctcataga aggtgaactg gagagcgatg aggcagagca atgtgacaag tatgacgccc aggcactctc agcccagctg gtgccatcac tctgctctgc tgtgtttgtg atcggtgtcc tggacaatct cctggttgtg cttatcctgg taaaatataa aggactcaaa cgcgtggaaa atatctatct tctaaacttg gcagtttcta acttgtgttt cttgcttacc ctgcccttct gggctcatgc tgggggcgat cccatgtgta aaattctcat tggactgtac ttcgtgggcc tgtacagtga gacatttttc aattgccttc tgactgtgca aaggtaccta gtgtttttgc acaagggaaa ctttttctca gccaggagga gggtgccctg tggcatcatt acaagtgtcc tggcatgggt aacagccatt ctggccactt tgcctgaatt cgtggtttat aaacctcaga tggaagacca gaaatacaag tgtgcattta gcagaactcc cttcctgcca gctgatgaga cattctggaa gcattttctg actttaaaaa tgaacatttc ggttcttgtc ctccccctat ttatttttac atttctctat gtgcaaatga gaaaaacact aaggttcagg gagcagaggt atagcctttt caagcttgtt tttgccataa tggtagtctt ccttctgatg tgggcgccct acaatattgc atttttcctg tccactttca aagaacactt ctccctgagt gactgcaaga gcagctacaa tctggacaaa agtgttcaca tcactaaact catcgccacc acccactgct gcatcaaccc tctcctgtat gcgtttcttg atgggacatt tagcaaatac ctctgccgct gtttccatct gcgtagtaac accccacttc aacccagggg gcagtctgca caaggcacat cgagggaaga acctgaccat tccaccgaag tgtaa. It is sometimes possible for the material contained within the vial of "CCRL2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.