Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

C19orf10 cdna clone

C19orf10 cDNA Clone

Gene Names
MYDGF; IL25; IL27; SF20; IL27w; C19orf10; R33729_1; EUROIMAGE1875335
Synonyms
C19orf10; C19orf10 cDNA Clone; C19orf10 cdna clone
Ordering
For Research Use Only!
Sequence
atggcggcgcccagcggagggtggaacggcgtcggcgcgagcttgtgggccgcgctgctcctaggggccgtggcgctgaggccggcggaggcggtgtccgagcccacgacggtggcgtttgacgtgcggcccggcggcgtcgtgcattccttctcccataacgtgggcccgggggacaaatatacgtgtatgttcacttacgcctctcaaggagggaccaatgagcaatggcagatgagtctggggaccagcgaagaccaccagcacttcacctgcaccatctggaggccccaggggaagtcctatctgtacttcacacagttcaaggcagaggtgcggggcgctgagattgagtacgccatggcctactctaaagccgcatttgaaagggaaagtgatgtccctctgaaaactgaggaatttgaagtgaccaaaacagcagtggctcacaggcccggggcattcaaagctgagctgtccaagctggtgattgtggccaaggcatcgcgcactgagctgtga
Sequence Length
522
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
18,795 Da
NCBI Official Full Name
Homo sapiens chromosome 19 open reading frame 10, mRNA
NCBI Official Synonym Full Names
myeloid derived growth factor
NCBI Official Symbol
MYDGF
NCBI Official Synonym Symbols
IL25; IL27; SF20; IL27w; C19orf10; R33729_1; EUROIMAGE1875335
NCBI Protein Information
myeloid-derived growth factor
UniProt Protein Name
Myeloid-derived growth factor
UniProt Gene Name
MYDGF
UniProt Synonym Gene Names
IL-25
UniProt Entry Name
MYDGF_HUMAN

NCBI Description

The protein encoded by this gene was previously thought to support proliferation of lymphoid cells and was considered an interleukin. However, this activity has not been reproducible and the function of this protein is currently unknown. [provided by RefSeq, Jul 2008]

Uniprot Description

MYDGF: was previously thought to support proliferation of lymphoid cells and was considered an interleukin. However, this activity has not been reproducible and the function of this protein is currently unknown. [provided by RefSeq, Jul 2008]

Protein type: Secreted, signal peptide; Secreted

Chromosomal Location of Human Ortholog: 19p13.3

Cellular Component: endoplasmic reticulum lumen; extracellular space

Molecular Function: protein binding

Biological Process: negative regulation of apoptosis; positive regulation of angiogenesis; positive regulation of endothelial cell proliferation; positive regulation of MAPKKK cascade; positive regulation of phosphoinositide 3-kinase cascade; positive regulation of protein amino acid phosphorylation; positive regulation of protein kinase B signaling cascade; positive regulation of transcription from RNA polymerase II promoter

Research Articles on C19orf10

Similar Products

Product Notes

The C19orf10 mydgf (Catalog #AAA1275167) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcggcgc ccagcggagg gtggaacggc gtcggcgcga gcttgtgggc cgcgctgctc ctaggggccg tggcgctgag gccggcggag gcggtgtccg agcccacgac ggtggcgttt gacgtgcggc ccggcggcgt cgtgcattcc ttctcccata acgtgggccc gggggacaaa tatacgtgta tgttcactta cgcctctcaa ggagggacca atgagcaatg gcagatgagt ctggggacca gcgaagacca ccagcacttc acctgcacca tctggaggcc ccaggggaag tcctatctgt acttcacaca gttcaaggca gaggtgcggg gcgctgagat tgagtacgcc atggcctact ctaaagccgc atttgaaagg gaaagtgatg tccctctgaa aactgaggaa tttgaagtga ccaaaacagc agtggctcac aggcccgggg cattcaaagc tgagctgtcc aagctggtga ttgtggccaa ggcatcgcgc actgagctgt ga. It is sometimes possible for the material contained within the vial of "C19orf10, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.