Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CYP51A1 cdna clone

CYP51A1 cDNA Clone

Gene Names
CYP51A1; LDM; CP51; CYP51; CYPL1; P450L1; P450-14DM
Synonyms
CYP51A1; CYP51A1 cDNA Clone; CYP51A1 cdna clone
Ordering
For Research Use Only!
Sequence
atggcggcggcggctgggatgctgctgctgggcttgctgcaggcgggtgggtcggtgctgggccaggcgatggagaaggtgacaggcggcaacctcttgtccatgctgctgatcgcctgcgccttcaccctcagcctggtctacctgatccgtctggccgccggccacctggtccagctgcccgcaggggtgaaaagtcctccatacattttctccccaattccattccttgggcatgccatagcatttgggaaaagtccaattgaatttctagaaaatgcatatgagaagtatggacctgtatttagttttaccatggtaggcaagacatttacttaccttctggggagtgatgctgctgcactgctttttaatagtaaaaatgaagacctgaatgcagaagatgtctacagtcgcctgacaacacctgtgtttgggaagggagttgcatacgatgtgcctaatccagttttcttggagcagaagaaaatgttaaaaagtggccttaacatagcccactttaaacagcatgtttctataattgaaaaagaaacaaaggaatactttgagagttggggagaaagtggagaaaaaaatgtgtttgaagctctttctgagctcataattttaacagctagccattgtttgcatggaaaggaaatcagaagtcaactcaatgaaaaggtagcacagctgtatgcagatttggatggaggtttcagccatgcagcctggctcttaccaggttggctgcctttgcctagtttcagacgcagggacagagctcatcgggaaatcaaggatattttctataaggcaatccagaaacgcagacagtctcaagaaaaaattgatgacattctccaaactttactagatgctacatacaaggatgggcgtcctttgactgatgatgaagtagcagggatgcttattggattactcttggcagggcagcatacatcctcaactactagtgcttggatgggcttctttttggccagagacaaaacacttcaaaaaaaatgttatttagaacagaaaacagtctgtggagagaatctgcctcctttaacttatgaccagctcaaggatctaaatttacttgatcgctgtataaaagaaacattaagacttagacctcctgtaatgatcatgatgagaatggccagaactcctcagactgtggcagggtataccattcctccaggacatcaggtgtgtgtttctcccactgtcaatcaaagacttaaagactcatgggtagaacgcctggactttaatcctgatcgctacttacaggataacccagcatcaggggaaaagtttgcctatgtgccatttggagctgggcgtcatcgttgtattggggaaaattttgcctatgttcaaattaagacaatttggtccactatgcttcgtttatatgaatttgatctcattgatggatactttcccactgtgaattatacaactatgattcacacccctgaaaacccagttatccgttacaaacgaagatcaaaatga
Sequence Length
1530
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
46,312 Da
NCBI Official Full Name
Homo sapiens cytochrome P450, family 51, subfamily A, polypeptide 1, mRNA
NCBI Official Synonym Full Names
cytochrome P450 family 51 subfamily A member 1
NCBI Official Symbol
CYP51A1
NCBI Official Synonym Symbols
LDM; CP51; CYP51; CYPL1; P450L1; P450-14DM
NCBI Protein Information
lanosterol 14-alpha demethylase
UniProt Protein Name
Lanosterol 14-alpha demethylase
UniProt Gene Name
CYP51A1
UniProt Synonym Gene Names
CYP51; LDM; Cytochrome P45014DM
UniProt Entry Name
CP51A_HUMAN

NCBI Description

This gene encodes a member of the cytochrome P450 superfamily of enzymes. The cytochrome P450 proteins are monooxygenases which catalyze many reactions involved in drug metabolism and synthesis of cholesterol, steroids and other lipids. This endoplasmic reticulum protein participates in the synthesis of cholesterol by catalyzing the removal of the 14alpha-methyl group from lanosterol. Homologous genes are found in all three eukaryotic phyla, fungi, plants, and animals, suggesting that this is one of the oldest cytochrome P450 genes. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2009]

Uniprot Description

CYP51A1: Catalyzes C14-demethylation of lanosterol; it transforms lanosterol into 4,4'-dimethyl cholesta-8,14,24-triene-3-beta-ol. Belongs to the cytochrome P450 family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Oxidoreductase; EC 1.14.13.70; Membrane protein, integral; Lipid Metabolism - steroid biosynthesis

Chromosomal Location of Human Ortholog: 7q21.2

Cellular Component: endoplasmic reticulum; endoplasmic reticulum membrane; membrane; plasma membrane

Molecular Function: heme binding; sterol 14-demethylase activity

Biological Process: cholesterol biosynthetic process; cholesterol biosynthetic process via 24,25-dihydrolanosterol; steroid biosynthetic process; sterol metabolic process

Research Articles on CYP51A1

Similar Products

Product Notes

The CYP51A1 cyp51a1 (Catalog #AAA1275138) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcggcgg cggctgggat gctgctgctg ggcttgctgc aggcgggtgg gtcggtgctg ggccaggcga tggagaaggt gacaggcggc aacctcttgt ccatgctgct gatcgcctgc gccttcaccc tcagcctggt ctacctgatc cgtctggccg ccggccacct ggtccagctg cccgcagggg tgaaaagtcc tccatacatt ttctccccaa ttccattcct tgggcatgcc atagcatttg ggaaaagtcc aattgaattt ctagaaaatg catatgagaa gtatggacct gtatttagtt ttaccatggt aggcaagaca tttacttacc ttctggggag tgatgctgct gcactgcttt ttaatagtaa aaatgaagac ctgaatgcag aagatgtcta cagtcgcctg acaacacctg tgtttgggaa gggagttgca tacgatgtgc ctaatccagt tttcttggag cagaagaaaa tgttaaaaag tggccttaac atagcccact ttaaacagca tgtttctata attgaaaaag aaacaaagga atactttgag agttggggag aaagtggaga aaaaaatgtg tttgaagctc tttctgagct cataatttta acagctagcc attgtttgca tggaaaggaa atcagaagtc aactcaatga aaaggtagca cagctgtatg cagatttgga tggaggtttc agccatgcag cctggctctt accaggttgg ctgcctttgc ctagtttcag acgcagggac agagctcatc gggaaatcaa ggatattttc tataaggcaa tccagaaacg cagacagtct caagaaaaaa ttgatgacat tctccaaact ttactagatg ctacatacaa ggatgggcgt cctttgactg atgatgaagt agcagggatg cttattggat tactcttggc agggcagcat acatcctcaa ctactagtgc ttggatgggc ttctttttgg ccagagacaa aacacttcaa aaaaaatgtt atttagaaca gaaaacagtc tgtggagaga atctgcctcc tttaacttat gaccagctca aggatctaaa tttacttgat cgctgtataa aagaaacatt aagacttaga cctcctgtaa tgatcatgat gagaatggcc agaactcctc agactgtggc agggtatacc attcctccag gacatcaggt gtgtgtttct cccactgtca atcaaagact taaagactca tgggtagaac gcctggactt taatcctgat cgctacttac aggataaccc agcatcaggg gaaaagtttg cctatgtgcc atttggagct gggcgtcatc gttgtattgg ggaaaatttt gcctatgttc aaattaagac aatttggtcc actatgcttc gtttatatga atttgatctc attgatggat actttcccac tgtgaattat acaactatga ttcacacccc tgaaaaccca gttatccgtt acaaacgaag atcaaaatga. It is sometimes possible for the material contained within the vial of "CYP51A1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.