Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

COL4A3BP cdna clone

COL4A3BP cDNA Clone

Gene Names
COL4A3BP; CERT; GPBP; CERTL; MRD34; STARD11
Synonyms
COL4A3BP; COL4A3BP cDNA Clone; COL4A3BP cdna clone
Ordering
For Research Use Only!
Sequence
atgtcggataatcagagctggaactcgtcgggctcggaggaggatccagagacggagtctgggccgcctgtggagcgctgcggggtcctcagtaagtggacaaactacattcatgggtggcaggatcgttgggtagttttgaaaaataatgctctgagttactacaaatctgaagatgaaacagagtatggctgcagaggatccatctgtcttagcaaggctgtcatcacacctcacgattttgatgaatgtcgatttgatattagtgtaaatgatagtgtttggtatcttcgtgctcaggatccagatcatagacagcaatggatagatgccattgaacagcacaagactgaatctggatatggatctgaatccagcttgcgtcgacatggctcaatggtgtccctggtgtctggagcaagtggctactctgcaacatccacctcttcattcaagaaaggccacagtttacgtgagaagttggctgaaatggaaacatttagagacatcttatgtagacaagttgacacgctacagaagtactttgatgcctgtgctgatgctgtctctaaggatgaacttcaaagggataaagtggtagaagatgatgaagatgactttcctacaacgcgttctgatggtgacttcttgcatagtaccaacggcaataaagaaaagttatttccacatgtgacaccaaaaggaattaatggtatagactttaaaggggaagcgataacttttaaagcaactactgctggaatccttgcaacactttctcattgtattgaactaatggttaaacgtgaggacagctggcagaagagactggataaggaaactgagaagaaaagaagaacagaggaagcatataaaaatgcaatgacagaacttaagaaaaaatcccactttggaggaccagattatgaagaaggccctaacagtctgattaatgaagaagagttctttgatgctgttgaagctgctcttgacagacaagataaaatagaagaacagtcacagagtgaaaaggtgagattacattggcctacatccttgccctctggagatgccttttcttctgtggggacacatagatttgtccaaaaggttgaagagatggtgcagaaccacatgacttactcattacaggatgtaggcggagatgccaattggcagttggttgtagaagaaggagaaatgaaggtatacagaagagaagtagaagaaaatgggattgttctggatcctttaaaagctacccatgcagttaaaggcgtcacaggacatgaagtctgcaattatttctggaatgttgacgttcgcaatgactgggaaacaactatagaaaactttcatgtggtggaaacattagctgataatgcaatcatcatttatcaaacacacaagagggtgtggcctgcttctcagcgagacgtattatatctttctgtcattcgaaagataccagccttgactgaaaatgaccctgaaacttggatagtttgtaatttttctgtggatcatgacagtgctcctctaaacaaccgatgtgtccgtgccaaaataaatgttgctatgatttgtcaaaccttggtaagcccaccagagggaaaccaggaaattagcagggacaacattctatgcaagattacatatgtagctaatgtgaaccctggaggatgggcaccagcctcagtgttaagggcagtggcaaagcgagagtatcctaaatttctaaaacgttttacttcttacgtccaagaaaaaactgcaggaaagcctattttgttctag
Sequence Length
1797
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
83,708 Da
NCBI Official Full Name
Homo sapiens collagen, type IV, alpha 3 (Goodpasture antigen) binding protein, mRNA
NCBI Official Synonym Full Names
collagen type IV alpha 3 binding protein
NCBI Official Symbol
COL4A3BP
NCBI Official Synonym Symbols
CERT; GPBP; CERTL; MRD34; STARD11
NCBI Protein Information
collagen type IV alpha-3-binding protein
UniProt Protein Name
Collagen type IV alpha-3-binding protein
UniProt Gene Name
COL4A3BP
UniProt Synonym Gene Names
CERT; STARD11; hCERT; GPBP; StARD11
UniProt Entry Name
C43BP_HUMAN

NCBI Description

This gene encodes a kinase that specifically phosphorylates the N-terminal region of the non-collagenous domain of the alpha 3 chain of type IV collagen, known as the Goodpasture antigen. Goodpasture disease is the result of an autoimmune response directed at this antigen. One isoform of this protein is also involved in ceramide intracellular transport. Three transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]

Uniprot Description

COL4A3BP: a protein with a lipid-binding domain that mediates intracellular trafficking of ceramide in a non-vesicular manner. Implicated in human autoimmune diseases via its association with the Goodpasture antigen. Phosphorylation on Ser-132 decreases the affinity toward phosphatidylinositol 4-phosphate at Golgi membranes and reduces ceramide transfer activity. GPBP has been reported to have Ser/Thr protein kinase activity towards the Goodpasture (GP) antigen, but lacks a conventional serine/threonine kinase domain. Two human isoforms of the human protein are produced by alternative splicing.

Protein type: Protein kinase, Ser/Thr (non-receptor); Lipid-binding; Protein kinase, atypical; Kinase, protein; EC 2.7.11.9; ATYPICAL group; COL4A3BP family

Chromosomal Location of Human Ortholog: 5q13.3

Cellular Component: cytosol; endoplasmic reticulum membrane; Golgi apparatus; nucleoplasm; perinuclear region of cytoplasm

Molecular Function: protein binding; protein kinase activity

Biological Process: protein amino acid phosphorylation; sphingolipid biosynthetic process

Disease: Mental Retardation, Autosomal Dominant 34

Research Articles on COL4A3BP

Similar Products

Product Notes

The COL4A3BP col4a3bp (Catalog #AAA1275004) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtcggata atcagagctg gaactcgtcg ggctcggagg aggatccaga gacggagtct gggccgcctg tggagcgctg cggggtcctc agtaagtgga caaactacat tcatgggtgg caggatcgtt gggtagtttt gaaaaataat gctctgagtt actacaaatc tgaagatgaa acagagtatg gctgcagagg atccatctgt cttagcaagg ctgtcatcac acctcacgat tttgatgaat gtcgatttga tattagtgta aatgatagtg tttggtatct tcgtgctcag gatccagatc atagacagca atggatagat gccattgaac agcacaagac tgaatctgga tatggatctg aatccagctt gcgtcgacat ggctcaatgg tgtccctggt gtctggagca agtggctact ctgcaacatc cacctcttca ttcaagaaag gccacagttt acgtgagaag ttggctgaaa tggaaacatt tagagacatc ttatgtagac aagttgacac gctacagaag tactttgatg cctgtgctga tgctgtctct aaggatgaac ttcaaaggga taaagtggta gaagatgatg aagatgactt tcctacaacg cgttctgatg gtgacttctt gcatagtacc aacggcaata aagaaaagtt atttccacat gtgacaccaa aaggaattaa tggtatagac tttaaagggg aagcgataac ttttaaagca actactgctg gaatccttgc aacactttct cattgtattg aactaatggt taaacgtgag gacagctggc agaagagact ggataaggaa actgagaaga aaagaagaac agaggaagca tataaaaatg caatgacaga acttaagaaa aaatcccact ttggaggacc agattatgaa gaaggcccta acagtctgat taatgaagaa gagttctttg atgctgttga agctgctctt gacagacaag ataaaataga agaacagtca cagagtgaaa aggtgagatt acattggcct acatccttgc cctctggaga tgccttttct tctgtgggga cacatagatt tgtccaaaag gttgaagaga tggtgcagaa ccacatgact tactcattac aggatgtagg cggagatgcc aattggcagt tggttgtaga agaaggagaa atgaaggtat acagaagaga agtagaagaa aatgggattg ttctggatcc tttaaaagct acccatgcag ttaaaggcgt cacaggacat gaagtctgca attatttctg gaatgttgac gttcgcaatg actgggaaac aactatagaa aactttcatg tggtggaaac attagctgat aatgcaatca tcatttatca aacacacaag agggtgtggc ctgcttctca gcgagacgta ttatatcttt ctgtcattcg aaagatacca gccttgactg aaaatgaccc tgaaacttgg atagtttgta atttttctgt ggatcatgac agtgctcctc taaacaaccg atgtgtccgt gccaaaataa atgttgctat gatttgtcaa accttggtaa gcccaccaga gggaaaccag gaaattagca gggacaacat tctatgcaag attacatatg tagctaatgt gaaccctgga ggatgggcac cagcctcagt gttaagggca gtggcaaagc gagagtatcc taaatttcta aaacgtttta cttcttacgt ccaagaaaaa actgcaggaa agcctatttt gttctag. It is sometimes possible for the material contained within the vial of "COL4A3BP, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.