RASL10B cdna clone
RASL10B cDNA Clone
Gene Names
RASL10B; RRP17; VTS58635
Synonyms
RASL10B; RASL10B cDNA Clone; RASL10B cdna clone
Sequence
atggtctccacctaccgggtggccgtgctgggggcgcgaggtgtgggcaagagtgccatcgtgcgccagttcttgtacaacgagttcagcgaggtctgcgtccccaccaccgcccgccgcctttacctgcctgctgtcgtcatgaacggccacgtgcacgacctccagatcctcgactttccacccatcagcgccttccctgtcaatacgctccaggagtgggcagacacctgctgcaggggactccggagtgtccacgcctacatcctggtctacgacatctgctgctttgacagctttgagtacgtcaagaccatccgccagcagatcctggagacgagggtgatcggaacctcagagacgcccatcatcatcgtgggcaacaagcgggacctgcagcgcggacgcgtgatcccgcgctggaacgtgtcgcacctggtacgcaagacctggaagtgcggctacgtggaatgctcggccaagtacaactggcacatcctgctgctcttcagcgagctgctcaagagcgtcggctgcgcccgttgcaagcacgtgcacgctgccctgcgcttccagggcgcgctgcgccgcaaccgctgcgccatcatgtga
Sequence Length
612
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
23,229 Da
NCBI Official Full Name
Homo sapiens RAS-like, family 10, member B, mRNA
NCBI Official Synonym Full Names
RAS like family 10 member B
NCBI Official Symbol
RASL10B
NCBI Official Synonym Symbols
RRP17; VTS58635
NCBI Protein Information
ras-like protein family member 10B
UniProt Protein Name
Ras-like protein family member 10B
Protein Family
UniProt Gene Name
RASL10B
UniProt Synonym Gene Names
RRP17
UniProt Entry Name
RSLAB_HUMAN
Uniprot Description
RASL10B: May facilitate the release of atrial natriuretic peptide by cardiomyocytes and hence play a role in the regulation of arterial pressure. Belongs to the small GTPase superfamily. Ras family.
Protein type: G protein, monomeric, Ras; G protein, monomeric; G protein
Chromosomal Location of Human Ortholog: 17q12
Biological Process: regulation of systemic arterial blood pressure by atrial natriuretic peptide
Research Articles on RASL10B
Similar Products
Product Notes
The RASL10B rasl10b (Catalog #AAA1274968) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggtctcca cctaccgggt ggccgtgctg ggggcgcgag gtgtgggcaa gagtgccatc gtgcgccagt tcttgtacaa cgagttcagc gaggtctgcg tccccaccac cgcccgccgc ctttacctgc ctgctgtcgt catgaacggc cacgtgcacg acctccagat cctcgacttt ccacccatca gcgccttccc tgtcaatacg ctccaggagt gggcagacac ctgctgcagg ggactccgga gtgtccacgc ctacatcctg gtctacgaca tctgctgctt tgacagcttt gagtacgtca agaccatccg ccagcagatc ctggagacga gggtgatcgg aacctcagag acgcccatca tcatcgtggg caacaagcgg gacctgcagc gcggacgcgt gatcccgcgc tggaacgtgt cgcacctggt acgcaagacc tggaagtgcg gctacgtgga atgctcggcc aagtacaact ggcacatcct gctgctcttc agcgagctgc tcaagagcgt cggctgcgcc cgttgcaagc acgtgcacgc tgccctgcgc ttccagggcg cgctgcgccg caaccgctgc gccatcatgt ga. It is sometimes possible for the material contained within the vial of "RASL10B, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
