Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

RAB5A cdna clone

RAB5A cDNA Clone

Gene Names
RAB5A; RAB5
Synonyms
RAB5A; RAB5A cDNA Clone; RAB5A cdna clone
Ordering
For Research Use Only!
Sequence
atggctagtcgaggcgcaacaagacccaacgggccaaatactggaaataaaatatgccagttcaaactagtacttctgggagagtccgctgttggcaaatcaagcctagtgcttcgttttgtgaaaggccaatttcatgaatttcaagagagtaccattggggctgcttttctaacccaaactgtatgtcttgatgacactacagtaaagtttgaaatatgggatacagctggtcaagaacgataccatagcctagcaccaatgtactacagaggagcacaagcagccatagttgtatatgatatcacaaatgaggagtcctttgcaagagcaaaaaattgggttaaagaacttcagaggcaagcaagtcctaacattgtaatagctttatcgggaaacaaggccgacctagcaaataaaagagcagtagatttccaggaagcacagtcctatgcagatgacaatagtttattattcatggagacatccgctaaaacatcaatgaatgtaaatgaaatattcatggcaatagctaaaaaattgccaaagaatgaaccacaaaatccaggagcaaattctgccagaggaagaggagtagaccttaccgaacccacacaaccaaccaggaatcagtgttgtagtaactaa
Sequence Length
648
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
22,178 Da
NCBI Official Full Name
Homo sapiens RAB5A, member RAS oncogene family, mRNA
NCBI Official Synonym Full Names
RAB5A, member RAS oncogene family
NCBI Official Symbol
RAB5A
NCBI Official Synonym Symbols
RAB5
NCBI Protein Information
ras-related protein Rab-5A
UniProt Protein Name
Ras-related protein Rab-5A
Protein Family
UniProt Gene Name
RAB5A
UniProt Synonym Gene Names
RAB5
UniProt Entry Name
RAB5A_HUMAN

Uniprot Description

RAB5A: Required for the fusion of plasma membranes and early endosomes. Contributes to the regulation of filopodia extension. Binds EEA1. Interacts with RIN1 and GAPVD1, which regulate its pathway, probably by acting as a GEF. Interacts with ALS2CL, RABEP1, SUN2, ZFYVE20 and RUFY1. Interacts with SGSM1 and SGSM3. Interacts with PIK3CB. Regulated by guanine nucleotide exchange factors (GEFs) which promote the exchange of bound GDP for free GTP. Belongs to the small GTPase superfamily. Rab family.

Protein type: G protein; G protein, monomeric, Rab; G protein, monomeric; Motility/polarity/chemotaxis

Chromosomal Location of Human Ortholog: 3p24-p22

Cellular Component: axon; cell soma; cytoplasm; cytosol; dendrite; early endosome; endocytic vesicle; endosome; endosome membrane; nerve terminal; plasma membrane; synaptic vesicle; terminal button

Molecular Function: GDP binding; GTP binding; GTPase activity; protein binding

Biological Process: blood coagulation; early endosome to late endosome transport; endocytosis; positive regulation of exocytosis; regulation of endocytosis; regulation of endosome size; regulation of filopodium formation

Research Articles on RAB5A

Similar Products

Product Notes

The RAB5A rab5a (Catalog #AAA1274955) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggctagtc gaggcgcaac aagacccaac gggccaaata ctggaaataa aatatgccag ttcaaactag tacttctggg agagtccgct gttggcaaat caagcctagt gcttcgtttt gtgaaaggcc aatttcatga atttcaagag agtaccattg gggctgcttt tctaacccaa actgtatgtc ttgatgacac tacagtaaag tttgaaatat gggatacagc tggtcaagaa cgataccata gcctagcacc aatgtactac agaggagcac aagcagccat agttgtatat gatatcacaa atgaggagtc ctttgcaaga gcaaaaaatt gggttaaaga acttcagagg caagcaagtc ctaacattgt aatagcttta tcgggaaaca aggccgacct agcaaataaa agagcagtag atttccagga agcacagtcc tatgcagatg acaatagttt attattcatg gagacatccg ctaaaacatc aatgaatgta aatgaaatat tcatggcaat agctaaaaaa ttgccaaaga atgaaccaca aaatccagga gcaaattctg ccagaggaag aggagtagac cttaccgaac ccacacaacc aaccaggaat cagtgttgta gtaactaa. It is sometimes possible for the material contained within the vial of "RAB5A, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.