Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

BRD2 cdna clone

BRD2 cDNA Clone

Gene Names
BRD2; FSH; NAT; RNF3; FSRG1; RING3; D6S113E; O27.1.1
Synonyms
BRD2; BRD2 cDNA Clone; BRD2 cdna clone
Ordering
For Research Use Only!
Sequence
atgctgcaaaacgtgactccccacaataagctccctggggaagggaatgcagggttgctggggctgggcccagaagcagcagcaccagggaaaaggattcgaaaaccctctctcttgtatgagggctttgagagccccacaatggcttcggtgcctgctttgcaacttacccctgccaacccaccacccccggaggtgtccaatcccaaaaagccaggacgagttaccaaccagctgcaatacctacacaaggtagtgatgaaggctctgtggaaacatcagttcgcatggccattccggcagcctgtggatgctgtcaaactgggtctaccggattatcacaaaattataaaacagcctatggacatgggtactattaagaggagacttgaaaacaattattattgggctgcttcagagtgtatgcaagattttaataccatgttcaccaactgttacatttacaacaagcccactgatgatattgtcctaatggcacaaacgctggaaaagatattcctacagaaggttgcatcaatgccacaagaagaacaagagctggtagtgaccatccctaagaacagccacaagaagggggccaagttggcagcgctccagggcagtgttaccagtgcccatcaggtgcctgccgtctcttctgtgtcacacacagccctgtatactcctccacctgagatacctaccactgtcctcaacattccccacccatcagtcatttcctctccacttctcaagtccttgcactctgctggacccccgctccttgctgttactgcagctcctccagcccagccccttgccaagaaaaaaggcgtaaagcggaaagcagatactaccacccctacacctacagccatcttggctcctggttctccagctagccctcctgggagtcttgagcctaaggcagcacggcttccccctatgcgtagagagagtggtcgccccatcaagcccccacgcaaagacttgcctgactctcagcaacaacaccagagctctaagaaaggaaagctttcagaacagttaaaacattgcaatggcattttgaaggagttactctctaagaagcatgctgcctatgcttggcctttctataaaccagtggatgcttctgcacttggcctgcatgactaccatgacatcattaagcaccccatggacctcagcactgtcaagcggaagatggagaaccgtgattaccgggatgcacaggagtttgctgctgatgtacggcttatgttctccaactgctataagtacaatcccccagatcacgatgttgtggcaatggcacgaaagctacaggatgtatttgagttccgttatgccaagatgccagatgaaccactagaaccagggcctttaccagtctctactgccatgccccctggcttggccaaatcgtcttcagagtcctccagtgaggaaagtagcagtgagagctcctctgaggaagaggaggaggaagatgaggaggacgaggaggaagaagagagtgaaagctcagactcagaggaagaaagggctcatcgcttagcagaactacaggaacagcttcgggcagtacatgaacaactggctgctctgtcccagggtccaatatccaagcccaagaggaaaagagagaaaaaagagaaaaagaagaaacggaaggcagagaagcatcgaggccgagctggggccgatgaagatgacaaggggcctagggcaccccgcccacctcaacctaagaagtccaagaaagcaagtggcagtgggggtggcagtgctgctttaggcccttctggctttggaccttctggaggaagtggcaccaaactccaggctggagtgcagtggcgtgatctcggcttactgcaacctccacttctcgggttcaagcgattctcctgcctcagcctcccaagtagccaggattacaggctccccaaaaaggccacaaagacagccccacctgccctgcctacaggttatgattcagaggaggaggaagagagcaggcccatgagttacgatgagaagcggcagctgagcctggacatcaacaaattacctggggagaagctgggccgagttgtgcatataatccaagccagggagccctctttacgtgattcaaacccagaagagattgagattgattttgaaacactcaagccatccacacttagagagcttgagcgctatgtcctttcctgcctacgtaagaaaccccggaagccctacaccattaagaagcctgtgggaaagacaaaggaggaactggctttggagaaaaagcgggaattagaaaagcggttacaagatgtcagcggacagctcaattctactaaaaagccccccaagaaagcgaatgagaaaacagagtcatcctctgcacagcaagtagcagtgtcacgccttagcgcttccagctccagctcagattccagctcctcctcttcctcgtcgtcgtcttcagacaccagtgattcagactcaggctaa
Sequence Length
2511
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
74,881 Da
NCBI Official Full Name
Homo sapiens bromodomain containing 2, mRNA
NCBI Official Synonym Full Names
bromodomain containing 2
NCBI Official Symbol
BRD2
NCBI Official Synonym Symbols
FSH; NAT; RNF3; FSRG1; RING3; D6S113E; O27.1.1
NCBI Protein Information
bromodomain-containing protein 2
UniProt Protein Name
Bromodomain-containing protein 2
UniProt Gene Name
BRD2
UniProt Synonym Gene Names
KIAA9001; RING3
UniProt Entry Name
BRD2_HUMAN

NCBI Description

This gene encodes a transcriptional regulator that belongs to the BET (bromodomains and extra terminal domain) family of proteins. This protein associates with transcription complexes and with acetylated chromatin during mitosis, and it selectively binds to the acetylated lysine-12 residue of histone H4 via its two bromodomains. The gene maps to the major histocompatability complex (MHC) class II region on chromosome 6p21.3, but sequence comparison suggests that the protein is not involved in the immune response. This gene has been implicated in juvenile myoclonic epilepsy, a common form of epilepsy that becomes apparent in adolescence. Multiple alternatively spliced variants have been described for this gene. [provided by RefSeq, Dec 2010]

Uniprot Description

BRD2: an atypical protein kinase with two bromodomains that bind to acetylated lysine residues. Specifically interacts with transcriptionally active chromatin. Elevated protein kinase activity in leukemias. Transgenic mice overexpressing BRD2 in the lymphoid system develop diffuse large-cell lymphoma. Interacts with E2F1 and with histone H4 acetylated at Lys-13. May play a role in spermatogenesis or folliculogenesis. Genetic evidence links the BRD2 gene to both juvenile myoclonic epilepsy and photoparoxysomal responses. Two isoforms of the human protein are produced by alternative splicing.

Protein type: ATYPICAL group; BRD family; Kinase, protein; Protein kinase, Ser/Thr (non-receptor); Protein kinase, atypical

Chromosomal Location of Human Ortholog: 6p21.3

Molecular Function: chromatin binding; protein binding

Biological Process: nucleosome assembly; regulation of transcription from RNA polymerase II promoter; spermatogenesis

Research Articles on BRD2

Similar Products

Product Notes

The BRD2 brd2 (Catalog #AAA1274838) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgctgcaaa acgtgactcc ccacaataag ctccctgggg aagggaatgc agggttgctg gggctgggcc cagaagcagc agcaccaggg aaaaggattc gaaaaccctc tctcttgtat gagggctttg agagccccac aatggcttcg gtgcctgctt tgcaacttac ccctgccaac ccaccacccc cggaggtgtc caatcccaaa aagccaggac gagttaccaa ccagctgcaa tacctacaca aggtagtgat gaaggctctg tggaaacatc agttcgcatg gccattccgg cagcctgtgg atgctgtcaa actgggtcta ccggattatc acaaaattat aaaacagcct atggacatgg gtactattaa gaggagactt gaaaacaatt attattgggc tgcttcagag tgtatgcaag attttaatac catgttcacc aactgttaca tttacaacaa gcccactgat gatattgtcc taatggcaca aacgctggaa aagatattcc tacagaaggt tgcatcaatg ccacaagaag aacaagagct ggtagtgacc atccctaaga acagccacaa gaagggggcc aagttggcag cgctccaggg cagtgttacc agtgcccatc aggtgcctgc cgtctcttct gtgtcacaca cagccctgta tactcctcca cctgagatac ctaccactgt cctcaacatt ccccacccat cagtcatttc ctctccactt ctcaagtcct tgcactctgc tggacccccg ctccttgctg ttactgcagc tcctccagcc cagccccttg ccaagaaaaa aggcgtaaag cggaaagcag atactaccac ccctacacct acagccatct tggctcctgg ttctccagct agccctcctg ggagtcttga gcctaaggca gcacggcttc cccctatgcg tagagagagt ggtcgcccca tcaagccccc acgcaaagac ttgcctgact ctcagcaaca acaccagagc tctaagaaag gaaagctttc agaacagtta aaacattgca atggcatttt gaaggagtta ctctctaaga agcatgctgc ctatgcttgg cctttctata aaccagtgga tgcttctgca cttggcctgc atgactacca tgacatcatt aagcacccca tggacctcag cactgtcaag cggaagatgg agaaccgtga ttaccgggat gcacaggagt ttgctgctga tgtacggctt atgttctcca actgctataa gtacaatccc ccagatcacg atgttgtggc aatggcacga aagctacagg atgtatttga gttccgttat gccaagatgc cagatgaacc actagaacca gggcctttac cagtctctac tgccatgccc cctggcttgg ccaaatcgtc ttcagagtcc tccagtgagg aaagtagcag tgagagctcc tctgaggaag aggaggagga agatgaggag gacgaggagg aagaagagag tgaaagctca gactcagagg aagaaagggc tcatcgctta gcagaactac aggaacagct tcgggcagta catgaacaac tggctgctct gtcccagggt ccaatatcca agcccaagag gaaaagagag aaaaaagaga aaaagaagaa acggaaggca gagaagcatc gaggccgagc tggggccgat gaagatgaca aggggcctag ggcaccccgc ccacctcaac ctaagaagtc caagaaagca agtggcagtg ggggtggcag tgctgcttta ggcccttctg gctttggacc ttctggagga agtggcacca aactccaggc tggagtgcag tggcgtgatc tcggcttact gcaacctcca cttctcgggt tcaagcgatt ctcctgcctc agcctcccaa gtagccagga ttacaggctc cccaaaaagg ccacaaagac agccccacct gccctgccta caggttatga ttcagaggag gaggaagaga gcaggcccat gagttacgat gagaagcggc agctgagcct ggacatcaac aaattacctg gggagaagct gggccgagtt gtgcatataa tccaagccag ggagccctct ttacgtgatt caaacccaga agagattgag attgattttg aaacactcaa gccatccaca cttagagagc ttgagcgcta tgtcctttcc tgcctacgta agaaaccccg gaagccctac accattaaga agcctgtggg aaagacaaag gaggaactgg ctttggagaa aaagcgggaa ttagaaaagc ggttacaaga tgtcagcgga cagctcaatt ctactaaaaa gccccccaag aaagcgaatg agaaaacaga gtcatcctct gcacagcaag tagcagtgtc acgccttagc gcttccagct ccagctcaga ttccagctcc tcctcttcct cgtcgtcgtc ttcagacacc agtgattcag actcaggcta a. It is sometimes possible for the material contained within the vial of "BRD2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.