Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

RPS3A cdna clone

RPS3A cDNA Clone

Gene Names
RPS3A; S3A; FTE1; MFTL
Synonyms
RPS3A; RPS3A cDNA Clone; RPS3A cdna clone
Ordering
For Research Use Only!
Sequence
atggcggttggcaagaacaagcgccttacgaaaggcggcaaaaagggagccaagaagaaagtggttgatccattttctaagaaagattggtatgatgtgaaagcacctgctatgttcaatataagaaatattggaaagacgctcgtcaccaggacccaaggaaccaaaattgcatctgatggtctcaagggtcgtgtgtttgaagtgagtcttgctgatttgcagaatgatgaagttgcatttagaaaattcaagctgattactgaagatgttcagggtaaaaactgcctgactaacttccatggcatggatcttacccgtgacaaaatgtgttccatggtcaaaaaatggcagacaatgattgaagctcacgttgatgtcaagactaccgatggttacttgcttcgtctgttctgtgttggttttactaaaaaacgcaacaatcagatacggaagacctcttatgctcagcaccaacaggtccgccaaatccggaagaagatgatggaaatcatgacccgagaggtgcagacaaatgacttgaaagaagtggtcaataaattgattccagacagcattggaaaagacatagaaaaggcttgccaatctatttatcctctccatgatgtcttcgttagaaaagtaaaaatgctgaagaagcccaagtttgaattgggaaagctcatggagcttcatggtgaaggcagtagttctggaaaagccactggggacgagacaggtgctaaagttgaacgagctgatggatatgaaccaccagtccaagaatctgtttaa
Sequence Length
795
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
29,945 Da
NCBI Official Full Name
Homo sapiens ribosomal protein S3A, mRNA
NCBI Official Synonym Full Names
ribosomal protein S3A
NCBI Official Symbol
RPS3A
NCBI Official Synonym Symbols
S3A; FTE1; MFTL
NCBI Protein Information
40S ribosomal protein S3a
UniProt Protein Name
40S ribosomal protein S3a
Protein Family
UniProt Gene Name
RPS3A
UniProt Synonym Gene Names
Fte-1
UniProt Entry Name
RS3A_HUMAN

NCBI Description

Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 40S subunit. The protein belongs to the S3AE family of ribosomal proteins. It is located in the cytoplasm. Disruption of the gene encoding rat ribosomal protein S3a, also named v-fos transformation effector protein, in v-fos-transformed rat cells results in reversion of the transformed phenotype. This gene is co-transcribed with the U73A and U73B small nucleolar RNA genes, which are located in its fourth and third introns, respectively. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, May 2012]

Uniprot Description

RPS3A: ribosomal protein S3a. Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. Belongs to the S3AE family of ribosomal proteins. Located in the cytoplasm. Also named v-fos transformation effector protein.

Protein type: Ribosomal; Translation

Chromosomal Location of Human Ortholog: 4q31.2-q31.3

Cellular Component: cytoplasm; cytosol; extracellular matrix; focal adhesion; nucleolus; nucleoplasm; nucleus; ribonucleoprotein complex

Molecular Function: protein binding

Biological Process: mRNA catabolic process, nonsense-mediated decay; negative regulation of apoptosis; rRNA processing; SRP-dependent cotranslational protein targeting to membrane; translation; translational initiation; viral transcription

Research Articles on RPS3A

Similar Products

Product Notes

The RPS3A rps3a (Catalog #AAA1274812) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcggttg gcaagaacaa gcgccttacg aaaggcggca aaaagggagc caagaagaaa gtggttgatc cattttctaa gaaagattgg tatgatgtga aagcacctgc tatgttcaat ataagaaata ttggaaagac gctcgtcacc aggacccaag gaaccaaaat tgcatctgat ggtctcaagg gtcgtgtgtt tgaagtgagt cttgctgatt tgcagaatga tgaagttgca tttagaaaat tcaagctgat tactgaagat gttcagggta aaaactgcct gactaacttc catggcatgg atcttacccg tgacaaaatg tgttccatgg tcaaaaaatg gcagacaatg attgaagctc acgttgatgt caagactacc gatggttact tgcttcgtct gttctgtgtt ggttttacta aaaaacgcaa caatcagata cggaagacct cttatgctca gcaccaacag gtccgccaaa tccggaagaa gatgatggaa atcatgaccc gagaggtgca gacaaatgac ttgaaagaag tggtcaataa attgattcca gacagcattg gaaaagacat agaaaaggct tgccaatcta tttatcctct ccatgatgtc ttcgttagaa aagtaaaaat gctgaagaag cccaagtttg aattgggaaa gctcatggag cttcatggtg aaggcagtag ttctggaaaa gccactgggg acgagacagg tgctaaagtt gaacgagctg atggatatga accaccagtc caagaatctg tttaa. It is sometimes possible for the material contained within the vial of "RPS3A, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.