RAB30 cdna clone
RAB30 cDNA Clone
Synonyms
RAB30; RAB30 cDNA Clone; RAB30 cdna clone
Sequence
atgagtatggaagattatgatttcctgttcaaaattgttttaattggcaacgctggtgtggggaagacgtgcctcgtccgaagattcactcagggtcttttccccccaggtcaaggagccacaattggagttgattttatgattaagacagtggagattaatggtgaaaaagtaaagctacagatctgggacacagcaggtcaagagagatttcggtccattacccagagttactaccgaagcgccaatgccttgatcctcacctatgacattacctgtgaggaatccttccgttgccttcctgagtggctgcgggagatagaacaatatgccagcaacaaggtcatcactgtgttagtgggcaacaagattgacctggctgaaaggagagaggtttcccagcagcgagctgaagaattctcagaagctcaggacatgtattatctggagacctcagccaaggaatctgataatgtggagaaactcttccttgacttagcatgccgactcatcagtgaagccagacagaacacacttgtgaacaatgtatcctcacccttacctggagaagggaaaagcatcagctatttgacttgttgtaatttcaactaa
Sequence Length
612
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
18,994 Da
NCBI Official Full Name
Homo sapiens RAB30, member RAS oncogene family, mRNA
NCBI Official Synonym Full Names
RAB30, member RAS oncogene family
NCBI Official Symbol
RAB30
NCBI Protein Information
ras-related protein Rab-30
UniProt Protein Name
Ras-related protein Rab-30
Protein Family
UniProt Gene Name
RAB30
UniProt Entry Name
RAB30_HUMAN
Uniprot Description
RAB30: Belongs to the small GTPase superfamily. Rab family.
Protein type: G protein, monomeric; G protein, monomeric, Rab
Chromosomal Location of Human Ortholog: 11q14.1
Cellular Component: cis-Golgi network; cytoplasm; Golgi cisterna; Golgi membrane; Golgi stack; trans-Golgi network
Molecular Function: GTPase activity
Biological Process: Golgi organization and biogenesis
Research Articles on RAB30
Similar Products
Product Notes
The RAB30 rab30 (Catalog #AAA1274800) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgagtatgg aagattatga tttcctgttc aaaattgttt taattggcaa cgctggtgtg gggaagacgt gcctcgtccg aagattcact cagggtcttt tccccccagg tcaaggagcc acaattggag ttgattttat gattaagaca gtggagatta atggtgaaaa agtaaagcta cagatctggg acacagcagg tcaagagaga tttcggtcca ttacccagag ttactaccga agcgccaatg ccttgatcct cacctatgac attacctgtg aggaatcctt ccgttgcctt cctgagtggc tgcgggagat agaacaatat gccagcaaca aggtcatcac tgtgttagtg ggcaacaaga ttgacctggc tgaaaggaga gaggtttccc agcagcgagc tgaagaattc tcagaagctc aggacatgta ttatctggag acctcagcca aggaatctga taatgtggag aaactcttcc ttgacttagc atgccgactc atcagtgaag ccagacagaa cacacttgtg aacaatgtat cctcaccctt acctggagaa gggaaaagca tcagctattt gacttgttgt aatttcaact aa. It is sometimes possible for the material contained within the vial of "RAB30, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
