Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ARHGEF10 cdna clone

ARHGEF10 cDNA Clone

Gene Names
ARHGEF10; SNCV; GEF10
Synonyms
ARHGEF10; ARHGEF10 cDNA Clone; ARHGEF10 cdna clone
Ordering
For Research Use Only!
Sequence
atgcactcagatgaaatgatttatgatgatgttgagaatggggatgaaggtggaaacagctccttggaatacggatggagttcgagtgaatttgaaagttacgaagagcagagtgactcggagtgcaagaatgggattcccaggtccttcctgcgcagcaaccacaaaaagcaaatgcagaagctcgtgaaggccgcgaaggacggcaccaaggacgggctggagaggaccagggcagccgtgaagaggggccgctccttcatcaggaccaagtctctcatcgcacaggatcacagatcttctcttgaggaagaacagaatttgttcattgatgttgactgcaagcacccggaagccatcttgaccccgatgcccgagggtttatctcagcagcaggttgtaagaagatatatactgggttcagttgtcgacagtgaaaagaactacgtagatgctcttaagaggattttggagcaatatgagaagccgctgtctgagatggagccaaaggttctgagtgagaggaagctgaagacggtgttctaccgagtcaaagagatcctgcagtgccactcgctatttcagatcgcgctggccagccgcgtttccgagtgggactccgtggaaatgataggcgatgtcttcgtggcttcgttttctaagtccatggtgctggatgcatacagtgaatatgtgaacaatttcagcacagccgtggcagtcctcaagaaaacatgtgccacaaagcccgcttttcttgaatttttaaagcaggaacaggaggccagccccgatcgaaccacgctctacagcctgatgatgaagcccatccagaggttcccacagttcatcctcctgctccaggacatgctgaagaacacctccaaaggccaccccgacaggctgcctcttcagatggccctgacagagctcgaaacactagcagagaagttaaatgaaagaaagagagatgctgatcaacgctgtgaagtgaagcaaatagccaaagccataaacgaaagatacctgaacaagcttctcagcagtggaagccgatacctcattcgatcagatgatatgatagaaacagtttacaacgacagaggagagattgttaaaaccaaagaacgccgagtcttcatgttaaatgatgtgttaatgtgtgccaccgtcagctcacgcccctctcatgacagccgtgtgatgagcagccagaggtacttgctgaagtggagcgttccactgggacatgtggacgccatcgagtatggcagcagcgcaggcacgggcgagcacagcaggcaccttgccgttcacccgccggagagcctggccgtggttgctaacgcgaaaccaaacaaagtttacatggggccaggacaactgtatcaagatttacaaaacttgttgcatgacttaaatgtaattggccaaatcactcagctgataggaaaccttaaaggaaactatcagaacttaaaccagtcagtagcccatgactggacatcaggtttacaaaggcttattttgaagaaagaagatgaaatcagagctgcggactgctgcagaattcagttacagcttcccgggaagcaggacaaatctgggcgaccgacgttctttacagctgtgttcaatacgttcacccctgccatcaaggagtcctgggtcaacagcttacagatggccaagctcgccctagaggagaaccacatgggctggttctgtgtggaagacgatgggaatcacattaaaaaggagaagcatcctctcctcgtcggacacatgcccgtgatggtggccaagcagcaggagttcaagattgaatgtgctgcttataaccctgaaccttacctaaataatgaaagccagccagattcattttccacggcacatggtttcctgtgggtaagatgtgtttatttggttttggtacaagttcacagagaatcaacgttcatggtcggtgtgatgagagactga
Sequence Length
1983
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
148,869 Da
NCBI Official Full Name
Homo sapiens Rho guanine nucleotide exchange factor (GEF) 10, mRNA
NCBI Official Synonym Full Names
Rho guanine nucleotide exchange factor 10
NCBI Official Symbol
ARHGEF10
NCBI Official Synonym Symbols
SNCV; GEF10
NCBI Protein Information
rho guanine nucleotide exchange factor 10
UniProt Protein Name
Rho guanine nucleotide exchange factor 10
UniProt Gene Name
ARHGEF10
UniProt Synonym Gene Names
KIAA0294
UniProt Entry Name
ARHGA_HUMAN

NCBI Description

This gene encodes a Rho guanine nucleotide exchange factor (GEF). Rho GEFs regulate the activity of small Rho GTPases by stimulating the exchange of guanine diphosphate (GDP) for guanine triphosphate (GTP) and may play a role in neural morphogenesis. Mutations in this gene are associated with slowed nerve conduction velocity (SNCV). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]

Uniprot Description

ARHGEF10: May play a role in developmental myelination of peripheral nerves. Defects in ARHGEF10 are the cause of slowed nerve conduction velocity (SNCV). Affected individuals present a reduction in nerve conduction velocities without any clinical signs of peripheral or central nervous system dysfunction. SNCV inheritance is autosomal dominant. 5 isoforms of the human protein are produced by alternative splicing.

Protein type: GEFs; GEFs, Rac/Rho

Chromosomal Location of Human Ortholog: 8p23

Cellular Component: centrosome

Molecular Function: kinesin binding; protein binding; Rho guanyl-nucleotide exchange factor activity

Biological Process: centrosome duplication; myelination in the peripheral nervous system; positive regulation of stress fiber formation

Disease: Slowed Nerve Conduction Velocity, Autosomal Dominant

Research Articles on ARHGEF10

Similar Products

Product Notes

The ARHGEF10 arhgef10 (Catalog #AAA1274782) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcactcag atgaaatgat ttatgatgat gttgagaatg gggatgaagg tggaaacagc tccttggaat acggatggag ttcgagtgaa tttgaaagtt acgaagagca gagtgactcg gagtgcaaga atgggattcc caggtccttc ctgcgcagca accacaaaaa gcaaatgcag aagctcgtga aggccgcgaa ggacggcacc aaggacgggc tggagaggac cagggcagcc gtgaagaggg gccgctcctt catcaggacc aagtctctca tcgcacagga tcacagatct tctcttgagg aagaacagaa tttgttcatt gatgttgact gcaagcaccc ggaagccatc ttgaccccga tgcccgaggg tttatctcag cagcaggttg taagaagata tatactgggt tcagttgtcg acagtgaaaa gaactacgta gatgctctta agaggatttt ggagcaatat gagaagccgc tgtctgagat ggagccaaag gttctgagtg agaggaagct gaagacggtg ttctaccgag tcaaagagat cctgcagtgc cactcgctat ttcagatcgc gctggccagc cgcgtttccg agtgggactc cgtggaaatg ataggcgatg tcttcgtggc ttcgttttct aagtccatgg tgctggatgc atacagtgaa tatgtgaaca atttcagcac agccgtggca gtcctcaaga aaacatgtgc cacaaagccc gcttttcttg aatttttaaa gcaggaacag gaggccagcc ccgatcgaac cacgctctac agcctgatga tgaagcccat ccagaggttc ccacagttca tcctcctgct ccaggacatg ctgaagaaca cctccaaagg ccaccccgac aggctgcctc ttcagatggc cctgacagag ctcgaaacac tagcagagaa gttaaatgaa agaaagagag atgctgatca acgctgtgaa gtgaagcaaa tagccaaagc cataaacgaa agatacctga acaagcttct cagcagtgga agccgatacc tcattcgatc agatgatatg atagaaacag tttacaacga cagaggagag attgttaaaa ccaaagaacg ccgagtcttc atgttaaatg atgtgttaat gtgtgccacc gtcagctcac gcccctctca tgacagccgt gtgatgagca gccagaggta cttgctgaag tggagcgttc cactgggaca tgtggacgcc atcgagtatg gcagcagcgc aggcacgggc gagcacagca ggcaccttgc cgttcacccg ccggagagcc tggccgtggt tgctaacgcg aaaccaaaca aagtttacat ggggccagga caactgtatc aagatttaca aaacttgttg catgacttaa atgtaattgg ccaaatcact cagctgatag gaaaccttaa aggaaactat cagaacttaa accagtcagt agcccatgac tggacatcag gtttacaaag gcttattttg aagaaagaag atgaaatcag agctgcggac tgctgcagaa ttcagttaca gcttcccggg aagcaggaca aatctgggcg accgacgttc tttacagctg tgttcaatac gttcacccct gccatcaagg agtcctgggt caacagctta cagatggcca agctcgccct agaggagaac cacatgggct ggttctgtgt ggaagacgat gggaatcaca ttaaaaagga gaagcatcct ctcctcgtcg gacacatgcc cgtgatggtg gccaagcagc aggagttcaa gattgaatgt gctgcttata accctgaacc ttacctaaat aatgaaagcc agccagattc attttccacg gcacatggtt tcctgtgggt aagatgtgtt tatttggttt tggtacaagt tcacagagaa tcaacgttca tggtcggtgt gatgagagac tga. It is sometimes possible for the material contained within the vial of "ARHGEF10, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.