Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

ANXA4 cdna clone

ANXA4 cDNA Clone

Gene Names
ANXA4; ANX4; P32.5; PIG28; PP4-X; ZAP36; PAP-II; HEL-S-274
Synonyms
ANXA4; ANXA4 cDNA Clone; ANXA4 cdna clone
Ordering
For Research Use Only!
Sequence
atggccatggcaaccaaaggaggtactgtcaaagctgcttcaggattcaatgccatggaagatgcccagaccctgaggaaggccatgaaagggctcggcaccgatgaagacgccattattagcgtccttgcctaccgcaacaccgcccagcgccaggagatcaggacagcctacaagagcaccatcggcagggacttgatagacgacctgaagtcagaactgagtggcaacttcgagcaggtgattgtggggatgatgacgcccacggtgctgtatgacgtgcaagagctgcgaagggccatgaagggagccggcactgatgagggctgcctaattgagatcctggcctcccggacccctgaggagatccggcgcataagccaaacctaccagcagcaatatggacggagccttgaagatgacattcgctctgacacatcgttcatgttccagcgagtgctggtgtctctgtcagctggtgggagggatgaaggaaattatctggacgatgctctcgtgagacaggatgcccaggacctgtatgaggctggagagaagaaatgggggacagatgaggtgaaatttctaactgttctctgttcccggaaccgaaatcacctgttgcatgtgtttgatgaatacaaaaggatatcacagaaggatattgaacagagtattaaatctgaaacatctggtagctttgaagatgctctgctggctatagtaaagtgcatgaggaacaaatctgcatattttgctgaaaagctctataaatcgatgaagggcttgggcaccgatgataacaccctcatcagagtgatggtttctcgagcagaaattgacatgttggatatccgggcacacttcaagagactctatggaaagtctctgtactcgttcatcaagggtgacacatctggagactacaggaaagtactgcttgttctctgtggaggagatgattaa
Sequence Length
966
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
307
Molecular Weight
27,063 Da
NCBI Official Full Name
Homo sapiens annexin A4, mRNA
NCBI Official Synonym Full Names
annexin A4
NCBI Official Symbol
ANXA4
NCBI Official Synonym Symbols
ANX4; P32.5; PIG28; PP4-X; ZAP36; PAP-II; HEL-S-274
NCBI Protein Information
annexin A4
UniProt Protein Name
Annexin A4
Protein Family
UniProt Gene Name
ANXA4
UniProt Synonym Gene Names
ANX4; PAP-II
UniProt Entry Name
ANXA4_HUMAN

NCBI Description

Annexin IV (ANX4) belongs to the annexin family of calcium-dependent phospholipid binding proteins. Although their functions are still not clearly defined, several members of the annexin family have been implicated in membrane-related events along exocytotic and endocytotic pathways. ANX4 has 45 to 59% identity with other members of its family and shares a similar size and exon-intron organization. Isolated from human placenta, ANX4 encodes a protein that has possible interactions with ATP, and has in vitro anticoagulant activity and also inhibits phospholipase A2 activity. ANX4 is almost exclusively expressed in epithelial cells. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2016]

Uniprot Description

ANXA4: a calcium/phospholipid-binding protein which promotes membrane fusion and is involved in exocytosis. Annexins are a family of structurally related proteins whose common property is calcium-dependent binding to phospholipids. There are at least ten different annexins in mammalian species. Annexins do not contain signal peptides, yet some annexins (A1, A2 and A5) appear to be secreted in a physiologically regulated fashion.

Protein type: Calcium-binding; Lipid-binding

Chromosomal Location of Human Ortholog: 2p13

Cellular Component: cell surface; cytoplasm; nuclear membrane; nucleus; perinuclear region of cytoplasm; plasma membrane; vesicle membrane

Molecular Function: calcium ion binding; calcium-dependent phospholipid binding; calcium-dependent protein binding; identical protein binding; NF-kappaB binding; protein binding

Biological Process: epithelial cell differentiation; inhibition of NF-kappaB transcription factor; negative regulation of apoptosis; regulation of transcription from RNA polymerase II promoter; signal transduction

Research Articles on ANXA4

Similar Products

Product Notes

The ANXA4 anxa4 (Catalog #AAA1274733) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggccatgg caaccaaagg aggtactgtc aaagctgctt caggattcaa tgccatggaa gatgcccaga ccctgaggaa ggccatgaaa gggctcggca ccgatgaaga cgccattatt agcgtccttg cctaccgcaa caccgcccag cgccaggaga tcaggacagc ctacaagagc accatcggca gggacttgat agacgacctg aagtcagaac tgagtggcaa cttcgagcag gtgattgtgg ggatgatgac gcccacggtg ctgtatgacg tgcaagagct gcgaagggcc atgaagggag ccggcactga tgagggctgc ctaattgaga tcctggcctc ccggacccct gaggagatcc ggcgcataag ccaaacctac cagcagcaat atggacggag ccttgaagat gacattcgct ctgacacatc gttcatgttc cagcgagtgc tggtgtctct gtcagctggt gggagggatg aaggaaatta tctggacgat gctctcgtga gacaggatgc ccaggacctg tatgaggctg gagagaagaa atgggggaca gatgaggtga aatttctaac tgttctctgt tcccggaacc gaaatcacct gttgcatgtg tttgatgaat acaaaaggat atcacagaag gatattgaac agagtattaa atctgaaaca tctggtagct ttgaagatgc tctgctggct atagtaaagt gcatgaggaa caaatctgca tattttgctg aaaagctcta taaatcgatg aagggcttgg gcaccgatga taacaccctc atcagagtga tggtttctcg agcagaaatt gacatgttgg atatccgggc acacttcaag agactctatg gaaagtctct gtactcgttc atcaagggtg acacatctgg agactacagg aaagtactgc ttgttctctg tggaggagat gattaa. It is sometimes possible for the material contained within the vial of "ANXA4, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.