Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

TOMM40 cdna clone

TOMM40 cDNA Clone

Gene Names
TOMM40; TOM40; PEREC1; C19orf1; PER-EC1; D19S1177E
Synonyms
TOMM40; TOMM40 cDNA Clone; TOMM40 cdna clone
Ordering
For Research Use Only!
Sequence
atggggaacgtgttggctgccagctcgccgcccgcagggccgccaccgccgcctgcgccggccctcgtggggctgccgccacctccgccctcgccgccgggcttcacgctgccgccgctgggaggcagcctgggcgccggcaccagtacgagtcgaagttcggaacggacccccggggctgcaaccgccagcgcctcaggggccgccgaggatggggcctgcggctgcctgcccaacccgggcacattcgaggagtgccaccggaagtgcaaggagctgtttcccattcagatggagggtgtcaagctcacagtcaacaaagggttgagtaaccattttcaggtcaaccacacagtagccctcagcacaatcggggagtccaactaccacttcggggtcacatatgtggggacaaagcagctgagtcccacagaggcgttccctgtactggtgggtgacatggacaacagtggcagtctcaacgctcaggtcattcaccagctgggccccggtctcaggtccaagatggccatccagacccagcagtcgaagtttgtgaactggcaggtggacggggagtatcggggctctgacttcacagcagccgtcaccctggggaacccagacgtcctcgtgggttcaggaatcctcgtagcccactacctccagagcatcacgccttgcctggccctgggtggagagctggtctaccaccggcggcctggagaggagggcactgtcatgtctctagctgggaaatacacattgaacaactggttggcaacggtaacgttgggccaggcgggcatgcacgcaacatactaccacaaagccagtgaccagctgcaggtgggtgtggagtttgaggccagcacaaggatgcaggacaccagcgtctccttcgggtaccagctggacctgcccaaggccaacctcctcttcaaaggctctgtggatagcaactggatcgtgggtgccacgctggagaagaagctcccacccctgcccctgacactggcccttggggccttcctgaatcaccgcaagaacaagtttcagtgtggctttggcctcaccatcggctga
Sequence Length
1086
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
34,441 Da
NCBI Official Full Name
Homo sapiens translocase of outer mitochondrial membrane 40 homolog (yeast), mRNA
NCBI Official Synonym Full Names
translocase of outer mitochondrial membrane 40
NCBI Official Symbol
TOMM40
NCBI Official Synonym Symbols
TOM40; PEREC1; C19orf1; PER-EC1; D19S1177E
NCBI Protein Information
mitochondrial import receptor subunit TOM40 homolog
UniProt Protein Name
Mitochondrial import receptor subunit TOM40 homolog
UniProt Gene Name
TOMM40
UniProt Synonym Gene Names
C19orf1; PEREC1; TOM40
UniProt Entry Name
TOM40_HUMAN

NCBI Description

The protein encoded by this gene is localized in the outer membrane of the mitochondria. It is the channel-forming subunit of the translocase of the mitochondrial outer membrane (TOM) complex that is essential for import of protein precursors into mitochondria. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Aug 2015]

Uniprot Description

TOMM40: Channel-forming protein essential for import of protein precursors into mitochondria. Belongs to the Tom40 family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Membrane protein, multi-pass; Mitochondrial

Chromosomal Location of Human Ortholog: 19q13

Cellular Component: cytoplasm; integral to membrane; integral to mitochondrial outer membrane; mitochondrial outer membrane; mitochondrial outer membrane translocase complex; mitochondrion; nucleoplasm

Molecular Function: protein channel activity; protein transmembrane transporter activity

Biological Process: macroautophagy; protein import into mitochondrial matrix; protein targeting to mitochondrion

Research Articles on TOMM40

Similar Products

Product Notes

The TOMM40 tomm40 (Catalog #AAA1274707) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggggaacg tgttggctgc cagctcgccg cccgcagggc cgccaccgcc gcctgcgccg gccctcgtgg ggctgccgcc acctccgccc tcgccgccgg gcttcacgct gccgccgctg ggaggcagcc tgggcgccgg caccagtacg agtcgaagtt cggaacggac ccccggggct gcaaccgcca gcgcctcagg ggccgccgag gatggggcct gcggctgcct gcccaacccg ggcacattcg aggagtgcca ccggaagtgc aaggagctgt ttcccattca gatggagggt gtcaagctca cagtcaacaa agggttgagt aaccattttc aggtcaacca cacagtagcc ctcagcacaa tcggggagtc caactaccac ttcggggtca catatgtggg gacaaagcag ctgagtccca cagaggcgtt ccctgtactg gtgggtgaca tggacaacag tggcagtctc aacgctcagg tcattcacca gctgggcccc ggtctcaggt ccaagatggc catccagacc cagcagtcga agtttgtgaa ctggcaggtg gacggggagt atcggggctc tgacttcaca gcagccgtca ccctggggaa cccagacgtc ctcgtgggtt caggaatcct cgtagcccac tacctccaga gcatcacgcc ttgcctggcc ctgggtggag agctggtcta ccaccggcgg cctggagagg agggcactgt catgtctcta gctgggaaat acacattgaa caactggttg gcaacggtaa cgttgggcca ggcgggcatg cacgcaacat actaccacaa agccagtgac cagctgcagg tgggtgtgga gtttgaggcc agcacaagga tgcaggacac cagcgtctcc ttcgggtacc agctggacct gcccaaggcc aacctcctct tcaaaggctc tgtggatagc aactggatcg tgggtgccac gctggagaag aagctcccac ccctgcccct gacactggcc cttggggcct tcctgaatca ccgcaagaac aagtttcagt gtggctttgg cctcaccatc ggctga. It is sometimes possible for the material contained within the vial of "TOMM40, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.