Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

TRIP6 cdna clone

TRIP6 cDNA Clone

Gene Names
TRIP6; OIP1; OIP-1; ZRP-1; TRIP-6; TRIP6i2
Synonyms
TRIP6; TRIP6 cDNA Clone; TRIP6 cdna clone
Ordering
For Research Use Only!
Sequence
atgtcggggcccacctggctgcccccgaagcagccggagcccgccagagcccctcaggggagggcgatcccccgcggcaccccggggccaccaccggcccacggagcagcactccagccccaccccagggtcaatttttgcccccttccatctgagcagtgttaccaggccccagggggaccggaggatcgggggccggcgtgggtggggtcccatggagtactccagcacacgcaggggctccctgcagacagggggggccttcgccctggaagcctggacgccgagatagacttgctgagcagcacgctggccgagctgaatgggggtcggggtcatgcgtcacggcgaccagaccgacaggcatatgagcccccgccacctcctgcctaccgcacgggctccctgaagccaaatccagcctcgccgctcccagcgtctccctatgggggccccactccagcctcttacactaccgccagcaccccggctggcccagccttccccgtgcaagtgaaggtggcacagccagtgaggggctgcggcccacccaggcggggagcctctcaggcctctgggcccctcccgggcccccactttcctctcccaggccgaggtgaagtctgggggcctggctataggagccagagagagccagggccaggggccaaagaggaagctgctggggtctctggccctgcaggaagaggaagaggaggcgagcacgggccccaggtgcccctgagccagcctccagaggatgagctggataggctgacgaagaagctggttcacgacatgaaccacccgcccagcggggagtactttggccagtgtggtggctgcggagaagatgtggttggggatggggctggggttgtggcctttgatcgcgtctttcacgtgggctgctttgtatgttctacatgccgggcccagcttcgcggccagcatttctacgccgtggagaggagggcatattgcgagggctgctacgtggccaccctggagaaatgtgccacgtgctcccagcccatcctggaccggatcctgcgggctatggggaaggcctaccaccctggctgcttcacctgcgtggtgtgtcaccgcggcctcgacggcatccccttcacagtggatgctacgagccagatccactgcattgaggactttcacaggaagtttgccccaagatgctcagtgtgcggtggggccataatgcctgagccaggtcaggaggagactgtgagaattgttgctctggatcgaagttttcacattggctgttacaagtgcgaggagtgtgggctgctgctctcctctgagggcgagtgtcagggctgctacccgctggatgggcacatcttgtgcaaggcctgcagcgcctggcgcatccaggagctctcagccaccgtcaccactgactgctga
Sequence Length
1431
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
8,277 Da
NCBI Official Full Name
Homo sapiens thyroid hormone receptor interactor 6, mRNA
NCBI Official Synonym Full Names
thyroid hormone receptor interactor 6
NCBI Official Symbol
TRIP6
NCBI Official Synonym Symbols
OIP1; OIP-1; ZRP-1; TRIP-6; TRIP6i2
NCBI Protein Information
thyroid receptor-interacting protein 6
UniProt Protein Name
Thyroid receptor-interacting protein 6
UniProt Gene Name
TRIP6
UniProt Synonym Gene Names
OIP1; TR-interacting protein 6; TRIP-6; OIP-1; ZRP-1
UniProt Entry Name
TRIP6_HUMAN

NCBI Description

This gene is a member of the zyxin family and encodes a protein with three LIM zinc-binding domains. This protein localizes to focal adhesion sites and along actin stress fibers. Recruitment of this protein to the plasma membrane occurs in a lysophosphatidic acid (LPA)-dependent manner and it regulates LPA-induced cell migration. Alternatively spliced variants which encode different protein isoforms have been described; however, not all variants have been fully characterized. [provided by RefSeq, Jul 2008]

Uniprot Description

TRIP6: thyroid receptor interacting protein 6 specifically interacts with the ligand-binding domain of the thyroid receptor (TR). Requires the presence of thyroid hormone for its interaction. Interacts with PTPN13. Functions downstream of the activated LPA(2) receptor and is involved in cell adhesion and migration.

Protein type: Motility/polarity/chemotaxis; Nuclear receptor co-regulator; Adaptor/scaffold

Chromosomal Location of Human Ortholog: 7q22

Cellular Component: cytoplasm; focal adhesion; interleukin-1 receptor complex; plasma membrane

Molecular Function: interleukin-1 receptor binding; kinase binding; protein binding

Biological Process: positive regulation of cell migration; release of cytoplasmic sequestered NF-kappaB

Research Articles on TRIP6

Similar Products

Product Notes

The TRIP6 trip6 (Catalog #AAA1274700) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgtcggggc ccacctggct gcccccgaag cagccggagc ccgccagagc ccctcagggg agggcgatcc cccgcggcac cccggggcca ccaccggccc acggagcagc actccagccc caccccaggg tcaatttttg cccccttcca tctgagcagt gttaccaggc cccaggggga ccggaggatc gggggccggc gtgggtgggg tcccatggag tactccagca cacgcagggg ctccctgcag acaggggggg ccttcgccct ggaagcctgg acgccgagat agacttgctg agcagcacgc tggccgagct gaatgggggt cggggtcatg cgtcacggcg accagaccga caggcatatg agcccccgcc acctcctgcc taccgcacgg gctccctgaa gccaaatcca gcctcgccgc tcccagcgtc tccctatggg ggccccactc cagcctctta cactaccgcc agcaccccgg ctggcccagc cttccccgtg caagtgaagg tggcacagcc agtgaggggc tgcggcccac ccaggcgggg agcctctcag gcctctgggc ccctcccggg cccccacttt cctctcccag gccgaggtga agtctggggg cctggctata ggagccagag agagccaggg ccaggggcca aagaggaagc tgctggggtc tctggccctg caggaagagg aagaggaggc gagcacgggc cccaggtgcc cctgagccag cctccagagg atgagctgga taggctgacg aagaagctgg ttcacgacat gaaccacccg cccagcgggg agtactttgg ccagtgtggt ggctgcggag aagatgtggt tggggatggg gctggggttg tggcctttga tcgcgtcttt cacgtgggct gctttgtatg ttctacatgc cgggcccagc ttcgcggcca gcatttctac gccgtggaga ggagggcata ttgcgagggc tgctacgtgg ccaccctgga gaaatgtgcc acgtgctccc agcccatcct ggaccggatc ctgcgggcta tggggaaggc ctaccaccct ggctgcttca cctgcgtggt gtgtcaccgc ggcctcgacg gcatcccctt cacagtggat gctacgagcc agatccactg cattgaggac tttcacagga agtttgcccc aagatgctca gtgtgcggtg gggccataat gcctgagcca ggtcaggagg agactgtgag aattgttgct ctggatcgaa gttttcacat tggctgttac aagtgcgagg agtgtgggct gctgctctcc tctgagggcg agtgtcaggg ctgctacccg ctggatgggc acatcttgtg caaggcctgc agcgcctggc gcatccagga gctctcagcc accgtcacca ctgactgctg a. It is sometimes possible for the material contained within the vial of "TRIP6, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.