Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

MDH2 cdna clone

MDH2 cDNA Clone

Gene Names
MDH2; MDH; MOR1; M-MDH; MGC:3559
Synonyms
MDH2; MDH2 cDNA Clone; MDH2 cdna clone
Ordering
For Research Use Only!
Sequence
atgctctccgccctcgcccggcctgtcagcgctgctctccgccgcagcttcagcacctcggcccagaacaatgctaaagtagctgtgctaggggcctctggaggcatcgggcagccactttcacttctcctgaagaacagccccttggtgagccgcctgaccctctatgatatcgcgcacacacccggagtggccgcagatctgagccacatcgagaccaaagccgctgtgaaaggctacctcggacctgaacagctgcctgactgcctgaaaggttgtgatgtggtagttattccggctggagtccccagaaagccaggcatgacccgggacgacctgttcaacaccaatgccacgattgtggccaccctgaccgctgcctgtgcccagcactgcccggaagccatgatctgcgtcattgccaatccggttaattccaccatccccatcacagcagaagttttcaagaagcatggagtgtacaaccccaacaaaatcttcggcgtgacgaccctggacatcgtcagagccaacacctttgttgcagagctgaagggtttggatccagctcgagtcaacgtccctgtcattggtggccatgctgggaagaccatcatccccctgatctctcagtgcacccccaaggtggactttccccaggaccagctgacagcactcactgggcggatccaggaggccggcacggaggtggtcaaggctaaagccggagcaggctctgccaccctctccatggcgtatgccggcgcccgctttgtcttctcccttgtggatgcaatgaatggaaaggaaggtgttgtggaatgttccttcgttaagtcacaggaaacggaatgtacctacttctccacaccgctgctgcttgggaaaaagggcatcgagaagaacctgggcatcggcaaagtctcctcttttgaggagaagatgatctcggatgccatccccgagctgaaggcctccatcaagaagggggaagatttcgtgaagaccctgaagtga
Sequence Length
1017
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
30,875 Da
NCBI Official Full Name
Homo sapiens malate dehydrogenase 2, NAD (mitochondrial), mRNA
NCBI Official Synonym Full Names
malate dehydrogenase 2
NCBI Official Symbol
MDH2
NCBI Official Synonym Symbols
MDH; MOR1; M-MDH; MGC:3559
NCBI Protein Information
malate dehydrogenase, mitochondrial
UniProt Protein Name
Malate dehydrogenase, mitochondrial
Protein Family
UniProt Gene Name
MDH2
UniProt Entry Name
MDHM_HUMAN

NCBI Description

Malate dehydrogenase catalyzes the reversible oxidation of malate to oxaloacetate, utilizing the NAD/NADH cofactor system in the citric acid cycle. The protein encoded by this gene is localized to the mitochondria and may play pivotal roles in the malate-aspartate shuttle that operates in the metabolic coordination between cytosol and mitochondria. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2013]

Uniprot Description

MDH2: mitochondrial malate dehydrogenase catalyzes the reversible oxidation of malate to oxaloacetate, utilizing the NAD/NADH cofactor system in the citric acid cycle. May play pivotal roles in the malate-aspartate shuttle that operates in the metabolic coordination between cytosol and mitochondria.

Protein type: Carbohydrate Metabolism - citrate (TCA) cycle; Oxidoreductase; Mitochondrial; Carbohydrate Metabolism - pyruvate; Carbohydrate Metabolism - glyoxylate and dicarboxylate; EC 1.1.1.37

Chromosomal Location of Human Ortholog: 7cen-q22

Cellular Component: mitochondrial matrix; mitochondrion; nucleoplasm; nucleus; plasma membrane

Molecular Function: L-malate dehydrogenase activity

Biological Process: gluconeogenesis; internal protein amino acid acetylation; malate metabolic process; tricarboxylic acid cycle

Research Articles on MDH2

Similar Products

Product Notes

The MDH2 mdh2 (Catalog #AAA1274639) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgctctccg ccctcgcccg gcctgtcagc gctgctctcc gccgcagctt cagcacctcg gcccagaaca atgctaaagt agctgtgcta ggggcctctg gaggcatcgg gcagccactt tcacttctcc tgaagaacag ccccttggtg agccgcctga ccctctatga tatcgcgcac acacccggag tggccgcaga tctgagccac atcgagacca aagccgctgt gaaaggctac ctcggacctg aacagctgcc tgactgcctg aaaggttgtg atgtggtagt tattccggct ggagtcccca gaaagccagg catgacccgg gacgacctgt tcaacaccaa tgccacgatt gtggccaccc tgaccgctgc ctgtgcccag cactgcccgg aagccatgat ctgcgtcatt gccaatccgg ttaattccac catccccatc acagcagaag ttttcaagaa gcatggagtg tacaacccca acaaaatctt cggcgtgacg accctggaca tcgtcagagc caacaccttt gttgcagagc tgaagggttt ggatccagct cgagtcaacg tccctgtcat tggtggccat gctgggaaga ccatcatccc cctgatctct cagtgcaccc ccaaggtgga ctttccccag gaccagctga cagcactcac tgggcggatc caggaggccg gcacggaggt ggtcaaggct aaagccggag caggctctgc caccctctcc atggcgtatg ccggcgcccg ctttgtcttc tcccttgtgg atgcaatgaa tggaaaggaa ggtgttgtgg aatgttcctt cgttaagtca caggaaacgg aatgtaccta cttctccaca ccgctgctgc ttgggaaaaa gggcatcgag aagaacctgg gcatcggcaa agtctcctct tttgaggaga agatgatctc ggatgccatc cccgagctga aggcctccat caagaagggg gaagatttcg tgaagaccct gaagtga. It is sometimes possible for the material contained within the vial of "MDH2, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.