RAB37 cdna clone
RAB37 cDNA Clone
Synonyms
RAB37; RAB37 cDNA Clone; RAB37 cdna clone
Sequence
atgacgggcacgccaggcgccgttgccacccgggatggcgaggcccccgagcgctccccgccctgcagtccgagctacgacctcacgggcaaggtgatgcttctgggagacacaggcgtcggcaaaacatgtttcctgatccaattcaaagacggggccttcctgtccggaaccttcatagccaccgtcggcatagacttcaggaacaaggtggtgactgtggatggcgtgagagtgaagctgcagatctgggacaccgctgggcaggaacggttccgaagcgtcacccatgcttattacagagatgctcaggccttgcttctgctgtatgacatcaccaacaaatcttctttcgacaacatcagggcctggctcactgagattcatgagtatgcccagagggacgtggtgatcatgctgctaggcaacaaggcggatatgagcagcgaaagagtgatccgttccgaagacggagagaccttggccagggagtacggtgttcccttcctggagaccagcgccaagactggcatgaatgtggagttagcctttctggccatcgccaaggaactgaaataccgggccgggcatcaggcggatgagcccagcttccagatccgagactatgtagagtcccagaagaagcgctccagctgctgctccttcatgtga
Sequence Length
672
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
20,894 Da
NCBI Official Full Name
Homo sapiens RAB37, member RAS oncogene family, mRNA
NCBI Official Synonym Full Names
RAB37, member RAS oncogene family
NCBI Official Symbol
RAB37
NCBI Protein Information
ras-related protein Rab-37
UniProt Protein Name
Ras-related protein Rab-37
Protein Family
UniProt Gene Name
RAB37
UniProt Entry Name
RAB37_HUMAN
NCBI Description
Rab proteins are low molecular mass GTPases that are critical regulators of vesicle trafficking. For additional background information on Rab proteins, see MIM 179508.[supplied by OMIM, Apr 2006]
Uniprot Description
RAB37: Belongs to the small GTPase superfamily. Rab family. 4 isoforms of the human protein are produced by alternative splicing
Protein type: G protein, monomeric, Rab; G protein, monomeric; G protein
Chromosomal Location of Human Ortholog: 17q25.1
Cellular Component: ER-Golgi intermediate compartment
Molecular Function: protein binding
Research Articles on RAB37
Similar Products
Product Notes
The RAB37 rab37 (Catalog #AAA1274636) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgacgggca cgccaggcgc cgttgccacc cgggatggcg aggcccccga gcgctccccg ccctgcagtc cgagctacga cctcacgggc aaggtgatgc ttctgggaga cacaggcgtc ggcaaaacat gtttcctgat ccaattcaaa gacggggcct tcctgtccgg aaccttcata gccaccgtcg gcatagactt caggaacaag gtggtgactg tggatggcgt gagagtgaag ctgcagatct gggacaccgc tgggcaggaa cggttccgaa gcgtcaccca tgcttattac agagatgctc aggccttgct tctgctgtat gacatcacca acaaatcttc tttcgacaac atcagggcct ggctcactga gattcatgag tatgcccaga gggacgtggt gatcatgctg ctaggcaaca aggcggatat gagcagcgaa agagtgatcc gttccgaaga cggagagacc ttggccaggg agtacggtgt tcccttcctg gagaccagcg ccaagactgg catgaatgtg gagttagcct ttctggccat cgccaaggaa ctgaaatacc gggccgggca tcaggcggat gagcccagct tccagatccg agactatgta gagtcccaga agaagcgctc cagctgctgc tccttcatgt ga. It is sometimes possible for the material contained within the vial of "RAB37, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
