Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

MCM10 cdna clone

MCM10 cDNA Clone

Gene Names
MCM10; CNA43; DNA43; PRO2249
Synonyms
MCM10; MCM10 cDNA Clone; MCM10 cdna clone
Ordering
For Research Use Only!
Sequence
atggacctgccgacgtgtggagccaggaacttaaaacaacatttagccaaagcctcagcttcagggattatggggagcccaaaaccagccatcaagtccatctcggcctcagcactcttgaagcaacagaagcagcggatgttggagatgaggagaaggaaatcagaagaaatacagaagcgatttctgcagagctcaagtgaagttgagagcccagctgtgccatcttcatcaagacagccccctgctcagcctccacggacaggatccgagttccccaggctggagggagccccggccacaatgacgcccaagctggggcgaggtgtcttggaaggagatgatgttctcttttatgatgagtcaccaccaccaagaccaaaactgagtgctttagcagaagccaaaaagttagctgctatcaccaaattaagggcaaaaggccaggttcttacaaaaacaaacccaaacagcattaagaagaaacaaaaggaccctcaggacatcctggaggtgaaggaacgtgtagaaaaaaacaccatgttttcttctcaagctgaggatgaattggagcctgccaggaaaaaaaggagagaacaacttgcctatctggaatctgaggaatttcagaaaatcctaaaagcaaaatcaaaacacacaggcatcctgaaagaggccgaggctgagatgcaggagcgctactttgagccactggtgaaaaaagaacaaatggaagaaaagatgagaaacatcagagaagtgaagtgccgtgtcgtgacatgcaagacgtgcgcctatacccacttcaagctgctggagacctgcgtcagtgagcagcatgaataccactggcatgatggtgtgaagaggtttttcaaatgtccctgtggaaacagaagcatctccttggacagactcccgaacaagcactgcagtaactgtggcctctacaaatgggaacgggacggaatgctaaaggaaaagactggtccaaagataggaggagaaactctgttaccaagaggagaagaacatgctaaatttctgaacagccttaaataa
Sequence Length
1062
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
98,084 Da
NCBI Official Full Name
Homo sapiens cDNA clone IMAGE:3451214
NCBI Official Synonym Full Names
minichromosome maintenance 10 replication initiation factor
NCBI Official Symbol
MCM10
NCBI Official Synonym Symbols
CNA43; DNA43; PRO2249
NCBI Protein Information
protein MCM10 homolog
UniProt Protein Name
Protein MCM10 homolog
UniProt Gene Name
MCM10
UniProt Synonym Gene Names
HsMCM10
UniProt Entry Name
MCM10_HUMAN

NCBI Description

The protein encoded by this gene is one of the highly conserved mini-chromosome maintenance proteins (MCM) that are involved in the initiation of eukaryotic genome replication. The hexameric protein complex formed by MCM proteins is a key component of the pre-replication complex (pre-RC) and it may be involved in the formation of replication forks and in the recruitment of other DNA replication related proteins. This protein can interact with MCM2 and MCM6, as well as with the origin recognition protein ORC2. It is regulated by proteolysis and phosphorylation in a cell cycle-dependent manner. Studies of a similar protein in Xenopus suggest that the chromatin binding of this protein at the onset of DNA replication is after pre-RC assembly and before origin unwinding. Alternatively spliced transcript variants encoding distinct isoforms have been identified. [provided by RefSeq, Jul 2008]

Uniprot Description

MCM10: Acts as a replication initiation factor that brings together the MCM2-7 helicase and the DNA polymerase alpha/primase complex in order to initiate DNA replication. Additionally, plays a role in preventing DNA damage during replication. Belongs to the MCM10 family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: DNA replication

Chromosomal Location of Human Ortholog: 10p13

Cellular Component: cytoplasm; nucleolus; nucleoplasm; nucleus

Molecular Function: DNA replication origin binding; identical protein binding; protein binding; single-stranded DNA binding

Biological Process: DNA replication; DNA replication initiation; G1/S transition of mitotic cell cycle; response to DNA damage stimulus

Research Articles on MCM10

Similar Products

Product Notes

The MCM10 mcm10 (Catalog #AAA1274628) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggacctgc cgacgtgtgg agccaggaac ttaaaacaac atttagccaa agcctcagct tcagggatta tggggagccc aaaaccagcc atcaagtcca tctcggcctc agcactcttg aagcaacaga agcagcggat gttggagatg aggagaagga aatcagaaga aatacagaag cgatttctgc agagctcaag tgaagttgag agcccagctg tgccatcttc atcaagacag ccccctgctc agcctccacg gacaggatcc gagttcccca ggctggaggg agccccggcc acaatgacgc ccaagctggg gcgaggtgtc ttggaaggag atgatgttct cttttatgat gagtcaccac caccaagacc aaaactgagt gctttagcag aagccaaaaa gttagctgct atcaccaaat taagggcaaa aggccaggtt cttacaaaaa caaacccaaa cagcattaag aagaaacaaa aggaccctca ggacatcctg gaggtgaagg aacgtgtaga aaaaaacacc atgttttctt ctcaagctga ggatgaattg gagcctgcca ggaaaaaaag gagagaacaa cttgcctatc tggaatctga ggaatttcag aaaatcctaa aagcaaaatc aaaacacaca ggcatcctga aagaggccga ggctgagatg caggagcgct actttgagcc actggtgaaa aaagaacaaa tggaagaaaa gatgagaaac atcagagaag tgaagtgccg tgtcgtgaca tgcaagacgt gcgcctatac ccacttcaag ctgctggaga cctgcgtcag tgagcagcat gaataccact ggcatgatgg tgtgaagagg tttttcaaat gtccctgtgg aaacagaagc atctccttgg acagactccc gaacaagcac tgcagtaact gtggcctcta caaatgggaa cgggacggaa tgctaaagga aaagactggt ccaaagatag gaggagaaac tctgttacca agaggagaag aacatgctaa atttctgaac agccttaaat aa. It is sometimes possible for the material contained within the vial of "MCM10, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.