Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

CD244 cdna clone

CD244 cDNA Clone

Gene Names
CD244; 2B4; NAIL; Nmrk; NKR2B4; SLAMF4
Synonyms
CD244; CD244 cDNA Clone; CD244 cdna clone
Ordering
For Research Use Only!
Sequence
atgctggggcaagtggtcaccctcatactcctcctgctcctcaaggtgtatcagggcaaaggatgccagggatcagctgaccatgtggttagcatctcgggagtgcctcttcagttacaaccaaacagcatacagacgaaggttgacagcattgcatggaagaagttgctgccctcacaaaatggatttcatcacatattgaagtgggagaatggctctttgccttccaatacttccaatgatagattcagttttatagtcaagaacttgagtcttctcatcaaggcagctcagcagcaggacagtggcctctactgcctggaggtcaccagtatatctggaaaagttcagacagccacgttccaggtttttgtatttgataaagttgagaaaccccgcctacaggggcaggggaagatcctggacagagggagatgccaagtggctctgtcttgcttggtctccagggatggcaatgtgtcctatgcttggtacagagggagcaagctgatccagacagcagggaacctcacctacctggacgaggaggttgacattaatggcactcacacatatacctgcaatgtcagcaatcctgttagctgggaaagccacaccctgaatctcactcaggactgtcagaatgcccatcaggaattcagattttggccgtttttggtgatcatcgtgattctaagcgcactgttccttggcacccttgcctgcttctgtgtgtggaggagaaagaggaaggagaagcagtcagagaccagtcccaaggaatttttgacaatttacgaagatgtcaaggatctgaaaaccaggagaaatcacgagcaggagcagacttttcctggaggggggagcaccatctactctatgatccagtcccagtcttctgctcccacgtcacaagaacctgcatatacattatattcattaattcagccttccaggaagtctggatccaggaagaggaaccacagcccttccttcaatagcactatctatgaagtgattggaaagagtcaacctaaagcccagaaccctgctcgattgagccgcaaagagctggagaactttgatgtttattcctag
Sequence Length
1098
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
30,784 Da
NCBI Official Full Name
Homo sapiens CD244 molecule, natural killer cell receptor 2B4, mRNA
NCBI Official Synonym Full Names
CD244 molecule
NCBI Official Symbol
CD244
NCBI Official Synonym Symbols
2B4; NAIL; Nmrk; NKR2B4; SLAMF4
NCBI Protein Information
natural killer cell receptor 2B4
UniProt Protein Name
Natural killer cell receptor 2B4
UniProt Gene Name
CD244
UniProt Synonym Gene Names
2B4; NAIL; NKR2B4; h2B4; SLAMF4
UniProt Entry Name
CD244_HUMAN

NCBI Description

This gene encodes a cell surface receptor expressed on natural killer (NK) cells (and some T cells) that mediate non-major histocompatibility complex (MHC) restricted killing. The interaction between NK-cell and target cells via this receptor is thought to modulate NK-cell cytolytic activity. Alternatively spliced transcript variants encoding different isoforms have been found for this gene.[provided by RefSeq, Oct 2009]

Uniprot Description

CD244: Modulate other receptor-ligand interactions to enhance leukocyte activation. 4 isoforms of the human protein are produced by alternative splicing.

Protein type: Receptor, misc.; Membrane protein, integral

Chromosomal Location of Human Ortholog: 1q23.3

Cellular Component: external side of plasma membrane; plasma membrane

Molecular Function: MHC class I protein binding; protein binding

Biological Process: leukocyte migration; natural killer cell activation during immune response; signal transduction

Disease: Rheumatoid Arthritis

Research Articles on CD244

Similar Products

Product Notes

The CD244 cd244 (Catalog #AAA1274587) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgctggggc aagtggtcac cctcatactc ctcctgctcc tcaaggtgta tcagggcaaa ggatgccagg gatcagctga ccatgtggtt agcatctcgg gagtgcctct tcagttacaa ccaaacagca tacagacgaa ggttgacagc attgcatgga agaagttgct gccctcacaa aatggatttc atcacatatt gaagtgggag aatggctctt tgccttccaa tacttccaat gatagattca gttttatagt caagaacttg agtcttctca tcaaggcagc tcagcagcag gacagtggcc tctactgcct ggaggtcacc agtatatctg gaaaagttca gacagccacg ttccaggttt ttgtatttga taaagttgag aaaccccgcc tacaggggca ggggaagatc ctggacagag ggagatgcca agtggctctg tcttgcttgg tctccaggga tggcaatgtg tcctatgctt ggtacagagg gagcaagctg atccagacag cagggaacct cacctacctg gacgaggagg ttgacattaa tggcactcac acatatacct gcaatgtcag caatcctgtt agctgggaaa gccacaccct gaatctcact caggactgtc agaatgccca tcaggaattc agattttggc cgtttttggt gatcatcgtg attctaagcg cactgttcct tggcaccctt gcctgcttct gtgtgtggag gagaaagagg aaggagaagc agtcagagac cagtcccaag gaatttttga caatttacga agatgtcaag gatctgaaaa ccaggagaaa tcacgagcag gagcagactt ttcctggagg ggggagcacc atctactcta tgatccagtc ccagtcttct gctcccacgt cacaagaacc tgcatataca ttatattcat taattcagcc ttccaggaag tctggatcca ggaagaggaa ccacagccct tccttcaata gcactatcta tgaagtgatt ggaaagagtc aacctaaagc ccagaaccct gctcgattga gccgcaaaga gctggagaac tttgatgttt attcctag. It is sometimes possible for the material contained within the vial of "CD244, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.