Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

TMEM30B cdna clone

TMEM30B cDNA Clone

Gene Names
TMEM30B; CDC50B
Synonyms
TMEM30B; TMEM30B cDNA Clone; TMEM30B cdna clone
Ordering
For Research Use Only!
Sequence
atgacctggagcgccacggcccggggcgcccaccagcccgacaacaccgccttcactcagcagcgcctccccgcctggcagccgctgctgtcggccagcatcgcgctgccgctcttcttctgcgcgggcctggccttcatcggcctgggcctgggcctctactactcctccaacggcatcaaggagctggagtacgactatacaggcgacccgggcaccggtaactgctcggtgtgcgccgcggctggccagggccgggcgctgccgcccccctgctcgtgcgcctggtacttctcgctgcccgagctcttccagggcccagtgtacctctactacgagctgaccaacttctaccagaacaaccggcgctacggcgtgtcccgcgacgacgcgcagctgagcggactccccagcgcgctgcgccaccctgtcaacgagtgcgccccctaccagcgcagcgcggccggcctgcccatcgcgccctgcggcgccatcgccaacagcctcttcaacgactccttctcgctttggcaccagcgccagcccggcgggccctacgtcgaggtgccgctcgaccgctccggcatcgcctggtggaccgactaccacgtcaagttccgcaacccgccgctggtcaacggcagcctggcgttggccttccagggcacggcgcccccgcccaactggcgccggccagtctacgagctcagccccgaccccaacaacaccggcttcatcaatcaggacttcgtggtgtggatgcgcacggcggcgctgcccacgttccgcaaactgtacgcgcgcatccgccagggcaactactcggccgggctgccgcggggcgcctaccgcgtcaacatcacctacaactacccggtgcgcgcgttcggcggccacaagctcctcatcttcagcagcatctcgtggatgggtggcaagaaccccttcctgggcatcgcctacctggtcgtcggctccctctgcatcctcaccggctttgtcatgctggtcgtctacattcgctaccaggaccaggacgacgacgacgaggagtga
Sequence Length
1056
Vector
Please Inquire

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
38,941 Da
NCBI Official Full Name
Homo sapiens transmembrane protein 30B, mRNA
NCBI Official Synonym Full Names
transmembrane protein 30B
NCBI Official Symbol
TMEM30B
NCBI Official Synonym Symbols
CDC50B
NCBI Protein Information
cell cycle control protein 50B
UniProt Protein Name
Cell cycle control protein 50B
UniProt Gene Name
TMEM30B
UniProt Synonym Gene Names
CDC50B
UniProt Entry Name
CC50B_HUMAN

Uniprot Description

TMEM30B: Belongs to the CDC50/LEM3 family.

Protein type: Membrane protein, multi-pass; Membrane protein, integral

Chromosomal Location of Human Ortholog: 14q23.1

Molecular Function: protein binding

Research Articles on TMEM30B

Similar Products

Product Notes

The TMEM30B tmem30b (Catalog #AAA1274523) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgacctgga gcgccacggc ccggggcgcc caccagcccg acaacaccgc cttcactcag cagcgcctcc ccgcctggca gccgctgctg tcggccagca tcgcgctgcc gctcttcttc tgcgcgggcc tggccttcat cggcctgggc ctgggcctct actactcctc caacggcatc aaggagctgg agtacgacta tacaggcgac ccgggcaccg gtaactgctc ggtgtgcgcc gcggctggcc agggccgggc gctgccgccc ccctgctcgt gcgcctggta cttctcgctg cccgagctct tccagggccc agtgtacctc tactacgagc tgaccaactt ctaccagaac aaccggcgct acggcgtgtc ccgcgacgac gcgcagctga gcggactccc cagcgcgctg cgccaccctg tcaacgagtg cgccccctac cagcgcagcg cggccggcct gcccatcgcg ccctgcggcg ccatcgccaa cagcctcttc aacgactcct tctcgctttg gcaccagcgc cagcccggcg ggccctacgt cgaggtgccg ctcgaccgct ccggcatcgc ctggtggacc gactaccacg tcaagttccg caacccgccg ctggtcaacg gcagcctggc gttggccttc cagggcacgg cgcccccgcc caactggcgc cggccagtct acgagctcag ccccgacccc aacaacaccg gcttcatcaa tcaggacttc gtggtgtgga tgcgcacggc ggcgctgccc acgttccgca aactgtacgc gcgcatccgc cagggcaact actcggccgg gctgccgcgg ggcgcctacc gcgtcaacat cacctacaac tacccggtgc gcgcgttcgg cggccacaag ctcctcatct tcagcagcat ctcgtggatg ggtggcaaga accccttcct gggcatcgcc tacctggtcg tcggctccct ctgcatcctc accggctttg tcatgctggt cgtctacatt cgctaccagg accaggacga cgacgacgag gagtga. It is sometimes possible for the material contained within the vial of "TMEM30B, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.