TTC5 cdna clone
TTC5 cDNA Clone
Gene Names
TTC5; Strap
Synonyms
TTC5; TTC5 cDNA Clone; TTC5 cdna clone
Sequence
atgatggctgatgaagaggaagaagtcaagccgatcttgcagaaattgcaggaactcgtggatcagctctactcatttcgagactgctatttcgagacacatagtgttgaggatgctgggaggaagcaacaggatgtgcggaaggagatggagaaaaccctacagcagatggaagaagtagtgggttctgtccagggcaaggcacaagttctaatgctaactgggaaagcactaaatgtgactcctgactatagccctaaggctgaggagcttctgtcaaaggctgtgaagctggagcccgagctggtggaagcctggaaccagctgggtgaggtgtactggaaaaaaggggatgttgcagctgcccacacctgcttctcaggagccctcacccattgcaggaacaaagtctccttgcaaaacctgtcaatggtgcttcgtcagctgcggactgacactgaagatgaacattctcaccatgtcatggacagtgtccgacaggctaagttggctgttcagatggatgtccatgatggccgctcctggtatattcttgggaattcatatctttccctttacttctctactggccagaaccctaagatctcccagcaagccctcagtgcctatgcccaagcagagaaagttgacagaaaagcttctagcaatcctgaccttcatctgaacagggcgacgttgcataaatatgaagagagttatggggaggccctggagggcttctctcgggctgcagccctggaccctgcctggccagagccccggcaacgagagcaacaacttctggaattcctggatagattaaccagcctccttgagagtaagggaaaggtgaagaccaaaaagctgcagagcatgctgggaagcttgcgcccagcccatctaggcccttgcagtgatgggcactatcagtcagcctctgggcagaaagtgaccctggagctcaagccactgagtacgcttcagcctggggtgaacagcggtgccgtcatcctgggaaaggtggtatttagcctcaccacagaggagaaagtcccctttacatttggcctggtagattcagatggaccttgctatgcagtgatggtgtacaatatagtgcagagctggggagtgctcattggagactctgtagccattcctgagcccaacctgcggcttcaccgaattcagcacaaaggaaaggactattccttttccagtgttcgagtggagacgcccctcctgctagtggtgaatgggaagcctcagggatccagcagccaggctgttgccacagtggcatcgcgaccacagtgtgaatga
Sequence Length
1323
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
48,928 Da
NCBI Official Full Name
Homo sapiens tetratricopeptide repeat domain 5, mRNA
NCBI Official Synonym Full Names
tetratricopeptide repeat domain 5
NCBI Official Symbol
TTC5
NCBI Official Synonym Symbols
Strap
NCBI Protein Information
tetratricopeptide repeat protein 5
UniProt Protein Name
Tetratricopeptide repeat protein 5
Protein Family
UniProt Gene Name
TTC5
UniProt Synonym Gene Names
TPR repeat protein 5; Strap
UniProt Entry Name
TTC5_HUMAN
Uniprot Description
TTC5: Adapter protein involved in p53/TP53 response that acts by regulating and mediating the assembly of multi-protein complexes. Required to facilitate the interaction between JMY and p300/EP300 and increase p53/TP53-dependent transcription and apoptosis. Prevents p53/TP53 degradation by MDM2.
Protein type: Adaptor/scaffold
Chromosomal Location of Human Ortholog: 14q11.2
Cellular Component: nucleoplasm
Molecular Function: protein binding
Research Articles on TTC5
Similar Products
Product Notes
The TTC5 ttc5 (Catalog #AAA1274499) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgatggctg atgaagagga agaagtcaag ccgatcttgc agaaattgca ggaactcgtg gatcagctct actcatttcg agactgctat ttcgagacac atagtgttga ggatgctggg aggaagcaac aggatgtgcg gaaggagatg gagaaaaccc tacagcagat ggaagaagta gtgggttctg tccagggcaa ggcacaagtt ctaatgctaa ctgggaaagc actaaatgtg actcctgact atagccctaa ggctgaggag cttctgtcaa aggctgtgaa gctggagccc gagctggtgg aagcctggaa ccagctgggt gaggtgtact ggaaaaaagg ggatgttgca gctgcccaca cctgcttctc aggagccctc acccattgca ggaacaaagt ctccttgcaa aacctgtcaa tggtgcttcg tcagctgcgg actgacactg aagatgaaca ttctcaccat gtcatggaca gtgtccgaca ggctaagttg gctgttcaga tggatgtcca tgatggccgc tcctggtata ttcttgggaa ttcatatctt tccctttact tctctactgg ccagaaccct aagatctccc agcaagccct cagtgcctat gcccaagcag agaaagttga cagaaaagct tctagcaatc ctgaccttca tctgaacagg gcgacgttgc ataaatatga agagagttat ggggaggccc tggagggctt ctctcgggct gcagccctgg accctgcctg gccagagccc cggcaacgag agcaacaact tctggaattc ctggatagat taaccagcct ccttgagagt aagggaaagg tgaagaccaa aaagctgcag agcatgctgg gaagcttgcg cccagcccat ctaggccctt gcagtgatgg gcactatcag tcagcctctg ggcagaaagt gaccctggag ctcaagccac tgagtacgct tcagcctggg gtgaacagcg gtgccgtcat cctgggaaag gtggtattta gcctcaccac agaggagaaa gtccccttta catttggcct ggtagattca gatggacctt gctatgcagt gatggtgtac aatatagtgc agagctgggg agtgctcatt ggagactctg tagccattcc tgagcccaac ctgcggcttc accgaattca gcacaaagga aaggactatt ccttttccag tgttcgagtg gagacgcccc tcctgctagt ggtgaatggg aagcctcagg gatccagcag ccaggctgtt gccacagtgg catcgcgacc acagtgtgaa tga. It is sometimes possible for the material contained within the vial of "TTC5, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
