Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

DUSP14 cdna clone

DUSP14 cDNA Clone

Gene Names
DUSP14; MKP6; MKP-L
Synonyms
DUSP14; DUSP14 cDNA Clone; DUSP14 cdna clone
Ordering
For Research Use Only!
Sequence
atgagctccagaggtcacagcacgctaccaaggactctcatggcccctcggatgatttccgagggagacataggaggcattgctcaaatcacctcctctctattcctgggcagaggcagtgtggcctccaatcggcacctcctccaggctcgtggcatcacctgcattgttaatgctaccattgagatccctaatttcaactggccccaatttgagtatgttaaagtgcctctggctgacatgccgcatgcccccattggactgtactttgacaccgtggctgacaagatccacagtgtgagcaggaagcacggggccaccttggtgcactgtgctgcaggggtgagccgctcagccacgctgtgtatcgcgtacctgatgaaattccacaacgtgtgcctgctggaggcgtacaactgggtgaaagcccggcgacctgtcatcaggcccaacgtaggcttctggaggcaactgatagactacgagcgccagctctttgggaagtcgacagttaaaatggtacagacaccttatggcatagttcccgacgtctatgagaaggagtcccgacacctgatgccttactgggggatttag
Sequence Length
597
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
22,255 Da
NCBI Official Full Name
Homo sapiens dual specificity phosphatase 14, mRNA
NCBI Official Synonym Full Names
dual specificity phosphatase 14
NCBI Official Symbol
DUSP14
NCBI Official Synonym Symbols
MKP6; MKP-L
NCBI Protein Information
dual specificity protein phosphatase 14
UniProt Protein Name
Dual specificity protein phosphatase 14
UniProt Gene Name
DUSP14
UniProt Synonym Gene Names
MKP6; MKP-L; MAP kinase phosphatase 6; MKP-6
UniProt Entry Name
DUS14_HUMAN

NCBI Description

Dual-specificity phosphatases (DUSPs) constitute a large heterogeneous subgroup of the type I cysteine-based protein-tyrosine phosphatase superfamily. DUSPs are characterized by their ability to dephosphorylate both tyrosine and serine/threonine residues. They have been implicated as major modulators of critical signaling pathways. DUSP14 contains the consensus DUSP C-terminal catalytic domain but lacks the N-terminal CH2 domain found in the MKP (mitogen-activated protein kinase phosphatase) class of DUSPs (see MIM 600714) (summary by Patterson et al., 2009 [PubMed 19228121]).[supplied by OMIM, Dec 2009]

Uniprot Description

MKP-6: a member of the dual specificity protein phosphatase subfamily. These phosphatases inactivate their target kinases by dephosphorylating both the phosphoserine/threonine and phosphotyrosine residues. They negatively regulate members of the mitogen-activated protein (MAP) kinase superfamily (ERK, JNK, p38). Is a negative regulator of T cell costimulation via CD28.

Protein type: EC 3.1.3.16; EC 3.1.3.48; Motility/polarity/chemotaxis; Protein phosphatase, dual-specificity

Chromosomal Location of Human Ortholog: 17q12

Molecular Function: protein binding

Research Articles on DUSP14

Similar Products

Product Notes

The DUSP14 dusp14 (Catalog #AAA1274496) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgagctcca gaggtcacag cacgctacca aggactctca tggcccctcg gatgatttcc gagggagaca taggaggcat tgctcaaatc acctcctctc tattcctggg cagaggcagt gtggcctcca atcggcacct cctccaggct cgtggcatca cctgcattgt taatgctacc attgagatcc ctaatttcaa ctggccccaa tttgagtatg ttaaagtgcc tctggctgac atgccgcatg cccccattgg actgtacttt gacaccgtgg ctgacaagat ccacagtgtg agcaggaagc acggggccac cttggtgcac tgtgctgcag gggtgagccg ctcagccacg ctgtgtatcg cgtacctgat gaaattccac aacgtgtgcc tgctggaggc gtacaactgg gtgaaagccc ggcgacctgt catcaggccc aacgtaggct tctggaggca actgatagac tacgagcgcc agctctttgg gaagtcgaca gttaaaatgg tacagacacc ttatggcata gttcccgacg tctatgagaa ggagtcccga cacctgatgc cttactgggg gatttag. It is sometimes possible for the material contained within the vial of "DUSP14, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.