Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

GLRA3 cdna clone

GLRA3 cDNA Clone

Synonyms
GLRA3; GLRA3 cDNA Clone; GLRA3 cdna clone
Ordering
For Research Use Only!
Sequence
atggcccacgtgagacactttcggacattagtttcgggattttacttctgggaagcagcactgttactcagtttggttgccacaaaggaaacagacagtgcaagatctcgaagtgctccaatgtcaccttctgattttctggataaattaatgggcaggacatcaggatatgatgcaagaatcagacccaattttaaaggccctccagttaatgtcacatgcaacatattcatcaacagctttggctctatcgcagagacgaccatggattacagagtgaatatctttcttcgtcagaaatggaatgatccccgcctcgcgtacagtgaatatcctgacgactctttagacctcgacccctccatgttggactccatttggaaacctgatttgttctttgccaatgaaaagggtgccaactttcatgaagtcactacagacaacaaattgctaagaattttcaaaaatggaaatgttctttattcaataagattaacattaacactttcctgtccaatggatctcaagaattttcccatggatgtacaaacatgtataatgcaactggaaagctttgggtacacaatgaatgatctcatttttgaatggcaagatgaggcacccgtacaagtggcagaaggactcactttgccccagtttctgttgaaagaagaaaaagatttacgatactgcactaaacattacaatacaggaaagtttacgtgtatagaagtgcgattccatctggagcgacaaatgggatactatctgatccagatgtacattcccagtctcctgattgttattctatcctgggtttcgttctggatcaacatggatgcagcaccggccagggtagctctggggataaccaccgtgctaacgatgactacacagagttcaggatcacgagcttccttgccaaaagtttcatatgtcaaagctattgatatttggatggcagtatgcctcctttttgtgttttcagcacttctggagtatgcagctgtaaattttgtatcaagacaacacaaagaacttctgagatttcgacgaaagagaaagaataagacagaagcctttgcactggagaagttttaccgtttctcagatatggatgatgaggtaagggaaagccgattcagcttcacagcctatggaatgggaccatgtctacaagcaaaggatggcatgactccaaagggccccaaccaccctgtccaggtaatgccaaaaagtcctgatgaaatgaggaaggtctttatcgaccgggccaagaagattgataccatctcccgagcctgcttcccattagcttttttgatttttaatattttctactgggttatctataaaattcttaggcatgaggatattcatcagcagcaagattaa
Sequence Length
1395
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
53,800Da
NCBI Official Full Name
Homo sapiens glycine receptor, alpha 3, mRNA
NCBI Official Synonym Full Names
glycine receptor alpha 3
NCBI Official Symbol
GLRA3
NCBI Protein Information
glycine receptor subunit alpha-3
UniProt Protein Name
Glycine receptor subunit alpha-3
Protein Family
UniProt Gene Name
GLRA3
UniProt Entry Name
GLRA3_HUMAN

NCBI Description

This gene encodes a member of the ligand-gated ion channel protein family. The encoded protein is a member of the glycine receptor subfamily. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2013]

Uniprot Description

GLRA3: The glycine receptor is a neurotransmitter-gated ion channel. Binding of glycine to its receptor increases the chloride conductance and thus produces hyperpolarization (inhibition of neuronal firing). Belongs to the ligand-gated ion channel (TC 1.A.9) family. Glycine receptor (TC 1.A.9.3) subfamily. GLRA3 sub- subfamily. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Transporter, ion channel; Membrane protein, integral; Transporter; Membrane protein, multi-pass

Chromosomal Location of Human Ortholog: 4q34.1

Cellular Component: integral to plasma membrane; plasma membrane

Molecular Function: extracellular-glycine-gated chloride channel activity; glycine binding; glycine-gated chloride ion channel activity

Biological Process: neuropeptide signaling pathway; protein homooligomerization; response to amino acid stimulus; synaptic transmission, glycinergic

Research Articles on GLRA3

Similar Products

Product Notes

The GLRA3 glra3 (Catalog #AAA1274441) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggcccacg tgagacactt tcggacatta gtttcgggat tttacttctg ggaagcagca ctgttactca gtttggttgc cacaaaggaa acagacagtg caagatctcg aagtgctcca atgtcacctt ctgattttct ggataaatta atgggcagga catcaggata tgatgcaaga atcagaccca attttaaagg ccctccagtt aatgtcacat gcaacatatt catcaacagc tttggctcta tcgcagagac gaccatggat tacagagtga atatctttct tcgtcagaaa tggaatgatc cccgcctcgc gtacagtgaa tatcctgacg actctttaga cctcgacccc tccatgttgg actccatttg gaaacctgat ttgttctttg ccaatgaaaa gggtgccaac tttcatgaag tcactacaga caacaaattg ctaagaattt tcaaaaatgg aaatgttctt tattcaataa gattaacatt aacactttcc tgtccaatgg atctcaagaa ttttcccatg gatgtacaaa catgtataat gcaactggaa agctttgggt acacaatgaa tgatctcatt tttgaatggc aagatgaggc acccgtacaa gtggcagaag gactcacttt gccccagttt ctgttgaaag aagaaaaaga tttacgatac tgcactaaac attacaatac aggaaagttt acgtgtatag aagtgcgatt ccatctggag cgacaaatgg gatactatct gatccagatg tacattccca gtctcctgat tgttattcta tcctgggttt cgttctggat caacatggat gcagcaccgg ccagggtagc tctggggata accaccgtgc taacgatgac tacacagagt tcaggatcac gagcttcctt gccaaaagtt tcatatgtca aagctattga tatttggatg gcagtatgcc tcctttttgt gttttcagca cttctggagt atgcagctgt aaattttgta tcaagacaac acaaagaact tctgagattt cgacgaaaga gaaagaataa gacagaagcc tttgcactgg agaagtttta ccgtttctca gatatggatg atgaggtaag ggaaagccga ttcagcttca cagcctatgg aatgggacca tgtctacaag caaaggatgg catgactcca aagggcccca accaccctgt ccaggtaatg ccaaaaagtc ctgatgaaat gaggaaggtc tttatcgacc gggccaagaa gattgatacc atctcccgag cctgcttccc attagctttt ttgattttta atattttcta ctgggttatc tataaaattc ttaggcatga ggatattcat cagcagcaag attaa. It is sometimes possible for the material contained within the vial of "GLRA3, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.