Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

DARC cdna clone

DARC cDNA Clone

Gene Names
ACKR1; FY; Dfy; GPD; DARC; GpFy; CCBP1; CD234; WBCQ1
Synonyms
DARC; DARC cDNA Clone; DARC cdna clone
Ordering
For Research Use Only!
Sequence
atggggaactgtctgcacagggcggagctctccccctcaactgagaactcaagtcagctggacttcgaagatgtatggaattcttcctatggtgtgaatgattccttcccagatggagactatggtgccaacctggaagcagctgccccctgccactcctgtaacctgctggatgactctgcactgcccttcttcatcctcaccagtgtcctgggtatcctagctagcagcactgtcctcttcatgcttttcagacctctcttccgctggcagctctgccctggctggcctgtcctggcacagctggctgtgggcagtgccctcttcagcattgtggtgcccgtcttggccccagggctaggtagcactcgcagctctgccctgtgtagcctgggctactgtgtctggtatggctcagcctttgcccaggctttgctgctagggtgccatgcctccctgggccacagactgggtgcaggccaggtcccaggcctcaccctggggctcactgtgggaatttggggagtggctgccctactgacactgcctgtcaccctggccagtggtgcttctggtggactctgcaccctgatatacagcacggagctgaaggctttgcaggccacacacactgtagcctgtcttgccatctttgtcttgttgccattgggtttgtttggagccaaggggctgaagaaggcattgggtatggggccaggcccctggatgaacatcctgtgggcctggtttattttctggtggcctcatggggtggttctaggactggatttcctggtgaggtccaagctgttgctgttgtcaacatgtctggcccagcaggctctggacctgctgctgaacctggcagaagccctggcaattttgcactgtgtggctacgcccctgctcctcgccctattctgccaccaggccacccgcaccctcttgccctctctgcccctccctgaaggatggttttctcatctggacacccttggaagcaaatcctag
Sequence Length
1011
Vector
pENTR223.1
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
35,678 Da
NCBI Official Full Name
Homo sapiens Duffy blood group, chemokine receptor, mRNA
NCBI Official Synonym Full Names
atypical chemokine receptor 1 (Duffy blood group)
NCBI Official Symbol
ACKR1
NCBI Official Synonym Symbols
FY; Dfy; GPD; DARC; GpFy; CCBP1; CD234; WBCQ1
NCBI Protein Information
atypical chemokine receptor 1
UniProt Protein Name
Atypical chemokine receptor 1
Protein Family
UniProt Gene Name
ACKR1
UniProt Synonym Gene Names
DARC; FY; GPD; GpFy
UniProt Entry Name
ACKR1_HUMAN

NCBI Description

The protein encoded by this gene is a glycosylated membrane protein and a non-specific receptor for several chemokines. The encoded protein is the receptor for the human malarial parasites Plasmodium vivax and Plasmodium knowlesi. Polymorphisms in this gene are the basis of the Duffy blood group system. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]

Uniprot Description

DARC: Non-specific receptor for many chemokines such as IL-8, GRO, RANTES, MCP-1 and TARC. It is also the receptor for the human malaria parasites Plasmodium vivax and Plasmodium knowlesi. Belongs to the G-protein coupled receptor Duffy family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Membrane protein, integral; GPCR, Duffy family; Membrane protein, multi-pass; Receptor, GPCR

Chromosomal Location of Human Ortholog: 1q21-q22

Cellular Component: plasma membrane

Molecular Function: C-C chemokine binding; receptor activity; transmembrane receptor activity

Biological Process: inflammatory response; regulation of chemokine production

Disease: Blood Group, Duffy System; Malaria, Susceptibility To; White Blood Cell Count Quantitative Trait Locus 1

Research Articles on DARC

Similar Products

Product Notes

The DARC ackr1 (Catalog #AAA1274402) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atggggaact gtctgcacag ggcggagctc tccccctcaa ctgagaactc aagtcagctg gacttcgaag atgtatggaa ttcttcctat ggtgtgaatg attccttccc agatggagac tatggtgcca acctggaagc agctgccccc tgccactcct gtaacctgct ggatgactct gcactgccct tcttcatcct caccagtgtc ctgggtatcc tagctagcag cactgtcctc ttcatgcttt tcagacctct cttccgctgg cagctctgcc ctggctggcc tgtcctggca cagctggctg tgggcagtgc cctcttcagc attgtggtgc ccgtcttggc cccagggcta ggtagcactc gcagctctgc cctgtgtagc ctgggctact gtgtctggta tggctcagcc tttgcccagg ctttgctgct agggtgccat gcctccctgg gccacagact gggtgcaggc caggtcccag gcctcaccct ggggctcact gtgggaattt ggggagtggc tgccctactg acactgcctg tcaccctggc cagtggtgct tctggtggac tctgcaccct gatatacagc acggagctga aggctttgca ggccacacac actgtagcct gtcttgccat ctttgtcttg ttgccattgg gtttgtttgg agccaagggg ctgaagaagg cattgggtat ggggccaggc ccctggatga acatcctgtg ggcctggttt attttctggt ggcctcatgg ggtggttcta ggactggatt tcctggtgag gtccaagctg ttgctgttgt caacatgtct ggcccagcag gctctggacc tgctgctgaa cctggcagaa gccctggcaa ttttgcactg tgtggctacg cccctgctcc tcgccctatt ctgccaccag gccacccgca ccctcttgcc ctctctgccc ctccctgaag gatggttttc tcatctggac acccttggaa gcaaatccta g. It is sometimes possible for the material contained within the vial of "DARC, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.