Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

FTSJ1 cdna clone

FTSJ1 cDNA Clone

Gene Names
FTSJ1; JM23; MRX9; SPB1; CDLIV; MRX44; TRMT7
Synonyms
FTSJ1; FTSJ1 cDNA Clone; FTSJ1 cdna clone
Ordering
For Research Use Only!
Sequence
atgggacggacgtcaaaggacaagcgggatgtctactaccgcctggccaaggagaatggctggcgtgctcgcagcgccttcaaactgctacaactggataaggaattccaactcttccaaggcgtgacacgggcagttgacctgtgtgcagccccaggcagctggagccaggtgctgagccagaagatcgggggccaagggtccggccacgtggtggctgtggacctgcaggctatggctccactaccaggtgtggtacagatccagggggacatcacccagctgtccactgccaaggagatcatccagcactttaagggctgccctgcggacctagtggtgtgtgacggggctcctgatgtaaccggtctccatgatgttgatgagtatatgcaggcccagctcctcctagctgctctgaacattgctacacatgtcctgaagccagggggctgctttgtggccaagatattccgaggccgggatgtgacgctcctctacagccagctgcaggtcttcttctccagcgtgctgtgtgccaagcccaggagcagccggaactctagcatcgaggccttcgctgtctgtcagggctatgaccctcccgagggcttcatcccggacctgagcaaacccctgctggaccattcttacgacccagatttcaaccagctggatggtcccacccgcatcattgtgccttttgtgacctgtggggacctgagctcctatgattcggaccgcagttacccactggacctagagggcggctcagagtacaagtacactccacccacacagccccccatctcgccaccataccaggaggcctgcacgttgaagaggaaggggcagctggccaaggagatccgcccccaggactgccccatcagcagagtggacacgtttccccagcccctggccgcccctcagtgccacaccctgctggcccctgagatggaagacaatgaaatgagttgttcaccttaa
Sequence Length
990
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
35,867 Da
NCBI Official Full Name
Homo sapiens FtsJ homolog 1 (E. coli), mRNA
NCBI Official Synonym Full Names
FtsJ RNA methyltransferase homolog 1 (E. coli)
NCBI Official Symbol
FTSJ1
NCBI Official Synonym Symbols
JM23; MRX9; SPB1; CDLIV; MRX44; TRMT7
NCBI Protein Information
putative tRNA (cytidine(32)/guanosine(34)-2'-O)-methyltransferase
UniProt Protein Name
Putative tRNA (cytidine(32)/guanosine(34)-2'-O)-methyltransferase
UniProt Gene Name
FTSJ1
UniProt Entry Name
TRM7_HUMAN

NCBI Description

This gene encodes a member of the methyltransferase superfamily. The encoded protein localizes to the nucleolus, binds to S-adenosylmethionine, and may be involved in the processing and modification of ribosomal RNA. Mutations in this gene are associated with mental retardation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2013]

Uniprot Description

FTSJ1: Defects in FTSJ1 are the cause of mental retardation X- linked type 44 (MRX44). Mental retardation is characterized by significantly sub-average general intellectual functioning associated with impairments in adaptative behavior and manifested during the developmental period. Non-syndromic mental retardation patients do not manifest other clinical signs. Belongs to the methyltransferase superfamily. RlmE family. 2 isoforms of the human protein are produced by alternative splicing.

Protein type: Methyltransferase; EC 2.1.1.205

Chromosomal Location of Human Ortholog: Xp11.23

Cellular Component: cytoplasm

Molecular Function: tRNA methyltransferase activity

Biological Process: tRNA methylation

Disease: Mental Retardation, X-linked 9

Research Articles on FTSJ1

Similar Products

Product Notes

The FTSJ1 ftsj1 (Catalog #AAA1274369) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgggacgga cgtcaaagga caagcgggat gtctactacc gcctggccaa ggagaatggc tggcgtgctc gcagcgcctt caaactgcta caactggata aggaattcca actcttccaa ggcgtgacac gggcagttga cctgtgtgca gccccaggca gctggagcca ggtgctgagc cagaagatcg ggggccaagg gtccggccac gtggtggctg tggacctgca ggctatggct ccactaccag gtgtggtaca gatccagggg gacatcaccc agctgtccac tgccaaggag atcatccagc actttaaggg ctgccctgcg gacctagtgg tgtgtgacgg ggctcctgat gtaaccggtc tccatgatgt tgatgagtat atgcaggccc agctcctcct agctgctctg aacattgcta cacatgtcct gaagccaggg ggctgctttg tggccaagat attccgaggc cgggatgtga cgctcctcta cagccagctg caggtcttct tctccagcgt gctgtgtgcc aagcccagga gcagccggaa ctctagcatc gaggccttcg ctgtctgtca gggctatgac cctcccgagg gcttcatccc ggacctgagc aaacccctgc tggaccattc ttacgaccca gatttcaacc agctggatgg tcccacccgc atcattgtgc cttttgtgac ctgtggggac ctgagctcct atgattcgga ccgcagttac ccactggacc tagagggcgg ctcagagtac aagtacactc cacccacaca gccccccatc tcgccaccat accaggaggc ctgcacgttg aagaggaagg ggcagctggc caaggagatc cgcccccagg actgccccat cagcagagtg gacacgtttc cccagcccct ggccgcccct cagtgccaca ccctgctggc ccctgagatg gaagacaatg aaatgagttg ttcaccttaa. It is sometimes possible for the material contained within the vial of "FTSJ1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.