Loading...

Skip to main content

Call us on + 1 (800) 604-9114 for more information about our products

Looking for specific datasheet Manual/COA/MSDS?
Request a Manual/COA/MSDS

Interested to get a quote about our products?
Request a Quote

PHF10 cdna clone

PHF10 cDNA Clone

Gene Names
PHF10; BAF45A; XAP135
Synonyms
PHF10; PHF10 cDNA Clone; PHF10 cdna clone
Ordering
For Research Use Only!
Sequence
atgcttcaagaacaagtcagtgaatatttgggtgtgacctcctttaaaaggaaatatccagagcgacgagatttgtctcacaaggagaaactctacctgagagagctaaatgtcattactgaaactcagtgcactctaggcttaacagcattgcgcagtgatgaagtgattgatttaatgataaaagaatatccagccaaacatgctgagtattctgttattctacaagaaaaagaacgtcaacgaattacagaccattataaagagtattcccaaatgcaacaacagaatactcagaaagttgaagccagtaaagtgcctgagtatattaagaaagctgccaaaaaagcagcagaatttaatagcaacttaaaccgggaacgcatggaagaaagaagagcttattttgacttgcagacacatgttatccaggtacctcaagggaagtacaaagttttgccaacagagcgaacaaaggtcagttcttacccagtggctctcatccccggacagttccaggaatattataagaggtactcaccagatgagctgcggtatctgccattaaacacagccctgtatgagccccctctggatcctgagctccctgctctagacagtgatggtgattcagatgatggcgaagatggtcgaggtgatgagaaacggaaaaataaaggcacttcggacagctcctctggcaatgtatctgaaggggaaagccctcctgacagccaggaggactctttccagggaagacagaaatcaaaagacaaagctgccactccaagaaaagatggtcccaaacgttctgtactgtccaagtcagttcctgggtacaagccaaaggtcattccaaatgctatatgtggaatttgtctgaagggtaaggagtccaacaagaaaggaaaggctgaatcacttatacactgctcccaatgtgagaatagtggccatccttcttgcctggatatgacaatggagcttgtttctatgattaagacctacccatggcagtgtatggaatgtaaaacatgcattatatgtggacaaccccaccatgaagaagaaatgatgttctgtgatatgtgtgacagaggttatcatactttttgtgtgggccttggtgctattccatcaggtcgctggatttgtgactgttgtcagcgggcccccccaacacccaggaaagtgggcagaagggggaaaaacagcaaagagggataa
Sequence Length
1227
Vector
pENTR223.1 or pUC
Clone Sequence Report
Provided with product shipment

NCBI and Uniprot Product Information

NCBI GI #
NCBI GeneID
Molecular Weight
51,290 Da
NCBI Official Full Name
Homo sapiens PHD finger protein 10, mRNA
NCBI Official Synonym Full Names
PHD finger protein 10
NCBI Official Symbol
PHF10
NCBI Official Synonym Symbols
BAF45A; XAP135
NCBI Protein Information
PHD finger protein 10
UniProt Protein Name
PHD finger protein 10
Protein Family
UniProt Gene Name
PHF10
UniProt Synonym Gene Names
BAF45A; BAF45a
UniProt Entry Name
PHF10_HUMAN

NCBI Description

This gene contains a predicted ORF that encodes a protein with two zinc finger domains. The function of the encoded protein is not known. Sequence analysis suggests that multiple alternatively spliced transcript variants are derived from this gene but the full-length nature of only two of them is known. These two splice variants encode different isoforms. A pseudogene for this gene is located on Xq28. [provided by RefSeq, Jul 2008]

Uniprot Description

PHF10: Involved in transcription activity regulation by chromatin remodeling. Belongs to the neural progenitors-specific chromatin remodeling complex (npBAF complex) and is required for the proliferation of neural progenitors. During neural development a switch from a stem/progenitor to a post-mitotic chromatin remodeling mechanism occurs as neurons exit the cell cycle and become committed to their adult state. The transition from proliferating neural stem/progenitor cells to post-mitotic neurons requires a switch in subunit composition of the npBAF and nBAF complexes. As neural progenitors exit mitosis and differentiate into neurons, npBAF complexes which contain ACTL6A/BAF53A and PHF10/BAF45A, are exchanged for homologous alternative ACTL6B/BAF53B and DPF1/BAF45B or DPF3/BAF45C subunits in neuron- specific complexes (nBAF). The npBAF complex is essential for the self-renewal/proliferative capacity of the multipotent neural stem cells. The nBAF complex along with CREST plays a role regulating the activity of genes essential for dendrite growth. Belongs to the SAYP family. 3 isoforms of the human protein are produced by alternative splicing.

Chromosomal Location of Human Ortholog: 6q27

Cellular Component: nucleus

Research Articles on PHF10

Similar Products

Product Notes

The PHF10 phf10 (Catalog #AAA1274359) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgcttcaag aacaagtcag tgaatatttg ggtgtgacct cctttaaaag gaaatatcca gagcgacgag atttgtctca caaggagaaa ctctacctga gagagctaaa tgtcattact gaaactcagt gcactctagg cttaacagca ttgcgcagtg atgaagtgat tgatttaatg ataaaagaat atccagccaa acatgctgag tattctgtta ttctacaaga aaaagaacgt caacgaatta cagaccatta taaagagtat tcccaaatgc aacaacagaa tactcagaaa gttgaagcca gtaaagtgcc tgagtatatt aagaaagctg ccaaaaaagc agcagaattt aatagcaact taaaccggga acgcatggaa gaaagaagag cttattttga cttgcagaca catgttatcc aggtacctca agggaagtac aaagttttgc caacagagcg aacaaaggtc agttcttacc cagtggctct catccccgga cagttccagg aatattataa gaggtactca ccagatgagc tgcggtatct gccattaaac acagccctgt atgagccccc tctggatcct gagctccctg ctctagacag tgatggtgat tcagatgatg gcgaagatgg tcgaggtgat gagaaacgga aaaataaagg cacttcggac agctcctctg gcaatgtatc tgaaggggaa agccctcctg acagccagga ggactctttc cagggaagac agaaatcaaa agacaaagct gccactccaa gaaaagatgg tcccaaacgt tctgtactgt ccaagtcagt tcctgggtac aagccaaagg tcattccaaa tgctatatgt ggaatttgtc tgaagggtaa ggagtccaac aagaaaggaa aggctgaatc acttatacac tgctcccaat gtgagaatag tggccatcct tcttgcctgg atatgacaat ggagcttgtt tctatgatta agacctaccc atggcagtgt atggaatgta aaacatgcat tatatgtgga caaccccacc atgaagaaga aatgatgttc tgtgatatgt gtgacagagg ttatcatact ttttgtgtgg gccttggtgc tattccatca ggtcgctgga tttgtgactg ttgtcagcgg gcccccccaa cacccaggaa agtgggcaga agggggaaaa acagcaaaga gggataa. It is sometimes possible for the material contained within the vial of "PHF10, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.

Precautions

All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.

Disclaimer

Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.

Item has been added to Shopping Cart

If you are ready to order, navigate to Shopping Cart and get ready to checkout.

Looking for a specific manual?
Request a Manual

Request more Information

Please complete the form below and a representative will contact you as soon as possible.

Request a Manual

Please complete the form below and a representative will contact you as soon as possible.

Request a Quote

Please complete the form below and a representative will contact you as soon as possible.