PHLDA1 cdna clone
PHLDA1 cDNA Clone
Gene Names
PHLDA1; PHRIP; TDAG51; DT1P1B11
Synonyms
PHLDA1; PHLDA1 cDNA Clone; PHLDA1 cdna clone
Sequence
atgctggagagtagcggctgcaaagcgctgaaggagggcgtgctggagaagcgcagcgacgggttgttgcagctctggaagaaaaagtgttgcatcctcaccgaggaagggctgctgcttatcccgcccaagcagctgcaacaccagcagcagcagcaacagcagcagcagcagcagcaacaacagcccgggcaggggccggccgagccgtcccaacccagtggccccgctgtcgccagcctcgagccgccggtcaagctcaaggaactgcacttctccaacatgaagaccgtggactgtgtggagcgcaagggcaagtacatgtacttcactgtggtgatggcagagggcaaggagatcgactttcggtgcccgcaagaccagggctggaacgccgagatcacgctgcagatggtgcagtacaagaatcgtcaggccatcctggcggtcaaatccacgcggcagaagcagcagcacctggtccagcagcagcccccctcgcagccgcagccgcagccgcagctccagccccaaccccagcctcagcctcagccgcaaccccagccccaatcacaaccccagcctcagccccaacccaagcctcagccccagcagctccacccgtatccgcatccacatccacatccacactctcatcctcactcgcacccacaccctcacccgcacccgcatccgcaccaaataccgcacccacacccacagccgcactcgcagccgcacgggcaccggcttctccgcagcacctccaactctgcctga
Sequence Length
780
Vector
Please Inquire
NCBI and Uniprot Product Information
NCBI GI #
NCBI GeneID
Molecular Weight
45,016 Da
NCBI Official Full Name
Homo sapiens pleckstrin homology-like domain, family A, member 1, mRNA
NCBI Official Synonym Full Names
pleckstrin homology like domain family A member 1
NCBI Official Symbol
PHLDA1
NCBI Official Synonym Symbols
PHRIP; TDAG51; DT1P1B11
NCBI Protein Information
pleckstrin homology-like domain family A member 1
UniProt Protein Name
Pleckstrin homology-like domain family A member 1
Protein Family
UniProt Gene Name
PHLDA1
UniProt Synonym Gene Names
PHRIP; TDAG51; PQ-rich protein; PQR protein
UniProt Entry Name
PHLA1_HUMAN
NCBI Description
This gene encodes an evolutionarily conserved proline-histidine rich nuclear protein. The encoded protein may play an important role in the anti-apoptotic effects of insulin-like growth factor-1. [provided by RefSeq, Jul 2008]
Uniprot Description
PHLDA1: Seems to be involved in regulation of apoptosis. May be involved in detachment-mediated programmed cell death. May mediate apoptosis during neuronal development. May be involved in regulation of anti-apoptotic effects of IGF1. May be involved in translational regulation.
Protein type: Nucleolus; Apoptosis
Chromosomal Location of Human Ortholog: 12q15
Cellular Component: cytosol
Molecular Function: protein binding
Biological Process: G2/M transition of mitotic cell cycle
Research Articles on PHLDA1
Similar Products
Product Notes
The PHLDA1 phlda1 (Catalog #AAA1274330) is a cDNA Clone and is intended for research purposes only. The product is available for immediate purchase. The amino acid sequence is listed below: atgctggaga gtagcggctg caaagcgctg aaggagggcg tgctggagaa gcgcagcgac gggttgttgc agctctggaa gaaaaagtgt tgcatcctca ccgaggaagg gctgctgctt atcccgccca agcagctgca acaccagcag cagcagcaac agcagcagca gcagcagcaa caacagcccg ggcaggggcc ggccgagccg tcccaaccca gtggccccgc tgtcgccagc ctcgagccgc cggtcaagct caaggaactg cacttctcca acatgaagac cgtggactgt gtggagcgca agggcaagta catgtacttc actgtggtga tggcagaggg caaggagatc gactttcggt gcccgcaaga ccagggctgg aacgccgaga tcacgctgca gatggtgcag tacaagaatc gtcaggccat cctggcggtc aaatccacgc ggcagaagca gcagcacctg gtccagcagc agcccccctc gcagccgcag ccgcagccgc agctccagcc ccaaccccag cctcagcctc agccgcaacc ccagccccaa tcacaacccc agcctcagcc ccaacccaag cctcagcccc agcagctcca cccgtatccg catccacatc cacatccaca ctctcatcct cactcgcacc cacaccctca cccgcacccg catccgcacc aaataccgca cccacaccca cagccgcact cgcagccgca cgggcaccgg cttctccgca gcacctccaa ctctgcctga. It is sometimes possible for the material contained within the vial of "PHLDA1, cDNA Clone" to become dispersed throughout the inside of the vial, particularly around the seal of said vial, during shipment and storage. We always suggest centrifuging these vials to consolidate all of the liquid away from the lid and to the bottom of the vial prior to opening. Please be advised that certain products may require dry ice for shipping and that, if this is the case, an additional dry ice fee may also be required.Precautions
All products in the AAA Biotech catalog are strictly for research-use only, and are absolutely not suitable for use in any sort of medical, therapeutic, prophylactic, in-vivo, or diagnostic capacity. By purchasing a product from AAA Biotech, you are explicitly certifying that said products will be properly tested and used in line with industry standard. AAA Biotech and its authorized distribution partners reserve the right to refuse to fulfill any order if we have any indication that a purchaser may be intending to use a product outside of our accepted criteria.Disclaimer
Though we do strive to guarantee the information represented in this datasheet, AAA Biotech cannot be held responsible for any oversights or imprecisions. AAA Biotech reserves the right to adjust any aspect of this datasheet at any time and without notice. It is the responsibility of the customer to inform AAA Biotech of any product performance issues observed or experienced within 30 days of receipt of said product. To see additional details on this or any of our other policies, please see our Terms & Conditions page.Item has been added to Shopping Cart
If you are ready to order, navigate to Shopping Cart and get ready to checkout.
